PRO

Where Your Ideas can change Minds

Please visit our new forum at

http://www.4forums.com

CON


YouDebate.com Forum
» back to YouDebate.com
Register | Profile | Log In | Lost Password | Active Users | Help | Board Rules | Search | FAQ |
Custom Search
» You are not logged in.   log in | register

  YouDebate.com Forum
   Creationism vs Evolution Debates
     SciAm - Evolution of Evolution

Topic Jump
« Back | Next »
[ Single page for this topic ]
Forum moderated by: admin
    

    
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

The January 2009 issue of Scientific American is devoted to topics on Evolution - celebrating the 150th anniversary of Darwin's publication of 'On the Origin of the Species'.  I'm going to pick up a copy.  It should be interesting reading.  

It even has an article entitled 'The Latest Face of Creationism'.  But for all you Creationists out there, don't expect it offer any support of your fallacious notions.
 


Posts: 1460 | Posted: 3:50 PM on December 30, 2008 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Here it is:
http://www.sciam.com/article.cfm?id=the-latest-face-of-creationism


-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 10:46 PM on December 30, 2008 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Creationists are defending academic freedom.
Same evidence, different interpretations based on philisophical presuppositions.
Everyone has a bias but which bias is best supported by the evidence?
We have an elite priesthood of 'scientists' making 'truth' pronouncements according to their naturalistic bias -attempting to force everybody into the same box and attempting to crunch the opposition by refusing to publish their papers and disallowing their progress in academia according to their personal prejudice.

That's dogma -let's get back to academic freedom!  


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 07:27 AM on January 11, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Academic freedom - what a joke!

The agenda of Creationists is to push their Christian religion to the public schools.  

Presenting Creationism as a science is clearly dishonest and misleading.  Creationism is NOT a science, and cannot be presented as a science.  If you want to rely on saying that 'God did it' - fine.  But that is not science.  We'd still be back in the Dark Ages if we relied on a 'God did it' mentality.  God is not measurable, testable, or identifyable.  

If you can prove me wrong, go ahead and present your evidence.
 


Posts: 1460 | Posted: 3:21 PM on January 11, 2009 | IP
Aswissrole

|      |       Report Post




Member
Post Score
Adjustment:
n/a

Rate this post:

Science freedom!

Ha.

Science is science. It doesn't care what people think. It doesn't care about freedom or fairness. If your argument is wrong then it is wrong, no matter how many people believe in it.

Creationism isn't a science and should never be considered as one. The scientific argument between Creationism and evolution ended about 100 years ago.
 


Posts: 69 | Posted: 4:28 PM on January 11, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Score for Lester10.

Thanks for the ammo, Aswisrole and orion.

1. Science is not a thinking entity. It doesn't care about fairness because it is not sentient. Science is people reaching for concensus.

2. If the argument ended 100 years ago, than why are we still debating? I'd wager that all four of us in this thread right now have a nearly identical public education.

3. The agenda for creationists is a little bit of equality. We ask only to present an alternative viewpoint to the government sponsored RELIGION called evolution.

4. Evolution is not measurable, testable ir identifyable either. The only difference is in interpretation.

I read the SciAm article two days ago. It is the same old tired arguments against academic freedom that colleges and universities have been using for years to intimidate and silence opposing viewpoints.

I have read nothing to make me even begin to question my INTERPRETATION of the evidence.
 


Posts: 226 | Posted: 3:50 PM on January 12, 2009 | IP
Aswissrole

|      |       Report Post




Member
Post Score
Adjustment:
n/a

Rate this post:

1. Precisly what I mean. Thank you for finding a better way of frasing it.

2. The scientific argument. Evolution is taught in schools, at least in my country (I'm British BTW). It is listed in acurate text books and has been the corner stone for studying palentology. Scientificly, Evolution is a fact. The public have yet to catch on though.

3. "government sponsored RELIGION called evolution".
Hmmm? I'm not sure what you mean by this. The government does not sponser Evolution. Especially not the American government. G Bush was a technologyphobe that did not employ a scientifc advisor for 3 months.

The only way George Bush sponsors evolution is by pointing out its obvius simularitiesd between us and chimps.


4. Evolution is identifieable by looking at the fossil record and recent changes in many organisums. As we continue to maintain accurate data about many creatures we will begin to see mutations in the population as a result of evolution. However, nothing major will happen quickly.

(Edited by Aswissrole 1/12/2009 at 5:46 PM).
 


Posts: 69 | Posted: 5:45 PM on January 12, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Hello, timbrx. Let's get started.

Score for Lester10.

Thanks for the ammo, Aswisrole and orion.

1. Science is not a thinking entity. It doesn't care about fairness because it is not sentient. Science is people reaching for concensus.


Okay, sure.


2. If the argument ended 100 years ago, than why are we still debating? I'd wager that all four of us in this thread right now have a nearly identical public education.


Scientific debate isn't conducted in the classroom. There are people who sleep through their 10th grade biology class and later claim that vaccines cause autism, but there's no question that they're wrong.


3. The agenda for creationists is a little bit of equality. We ask only to present an alternative viewpoint to the government sponsored RELIGION called evolution.


The agenda for creationism is quite clearly to establish theocracy. In a document entitled the Wedge Strategy, the Discovery Institute, the chief think tank behind creationism, intelligent design, and "academic freedom," specifically outlines the goal of pushing alternatives to evolution. They are twofold:

* "To defeat scientific materialism and its destructive moral, cultural, and political legacies"

* "To replace materialistic explanations with the theistic understanding that nature and human beings are created by God"



Moving on now, why do you call evolution a religion? It's my understanding that worship, some form of belief and behavioral guidelines, and knowledge rooted in faith rather than evidence are necessary tenets of religion. These tenets have literally nothing to do with any scientific theory.


4. Evolution is not measurable, testable ir identifyable either.


I don't mean to sound rude, but it doesn't look like you know what you're talking about here. What exactly do you mean "evolution is not identifiable"? You seem to be attaching criticism to evolution without understanding how evolution operates as a concept in science.

Evolution is indeed testable. Here is a list of testable predictions made by evolution from John A. Moore's book Science as a Way of Knowing: The Foundations of Modern Biology:


Deduction 1: If the hypothesis of evolution is true, the species that lived in the remote past must be different from the species alive today.

Deduction 2: If the hypothesis of evolution is true, the older the sedimentary strata, the less the chance of finding fossils of contemporary species.

Deduction 3: If the hypothesis of evolution is true, then we would expect to find only the simplest organisms in the very oldest strata and the more complex ones in more recent strata.

Deductlon 4: If the hypothesis of evolution is true, it must be possible to demonstrate the slow change of one species into another.

Deduction 5: If the hypothesis of evolution is true, which assumes that all of today's species are the descendants of a few original forms, there should have been connecting forms between the major groups (phyla, classes, orders).

Deduction 6: If the hypothesis of evolution is true, the age of the earth must be very great, possibly millions of years old.

Deduction 7: There must be variation among organisms if the hypothesis of evolution is true.

Deduction 8: Natural selection can be operative only if more offspring are born than survive.

Deduction 9: If the hypothesis of evolution is true, there must be differences between the offspring that survive and reproduce and those that do not.

Deduction 10: If the hypothesis of evolution is true, only those variations that are inherited will be important.

Deduction 11: If the members of a taxonomic unit, such as the phylum chordata, share a common ancestry, that fact should be reflected in their structure.

Deduction 12: If the members of a taxonomic unit share a common ancestry, that fact should be reflected in their embryonic development.

Deduction 13: If evolutionary divergence is the basis of organic diversity, that fact should be reflected in the system of classification.

Deduction 14: If there is a unity of life based on descent from a common ancestor, this should be reflected in the structure of cells.

Deduction 15: If there is a unity of life based on evolution, that fact should be reflected in the molecular processes of organisms.

"Deduction 16: If the idea (hypothesis) of evolution is to be established as true, we must be able to obtain information on organisms that lived in the past."


Every single one of these predictions has been tested and found to be true. Do you have any issue with these predictions?


The only difference is in interpretation.


Of course. When you interpret reality through evidence, you're going to come to very different conclusions from someone who interprets reality through preconceived beliefs and faith. What is your point here?


I read the SciAm article two days ago. It is the same old tired arguments against academic freedom that colleges and universities have been using for years to intimidate and silence opposing viewpoints.


Attempts to ruin our science education policy should be intimidated and silenced. Colleges and universities would utilize the exact same "old tired arguments against academic freedom" to prohibit teaching alchemy and astrology in chemistry and physics. Where is the problem?


I have read nothing to make me even begin to question my INTERPRETATION of the evidence.


This is not surprising. A reliance on evidence to form your beliefs is not a part of your worldview. You are not a scientist and clearly do not understand or value scientific thought.




(Edited by EntwickelnCollin 1/12/2009 at 6:44 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 6:36 PM on January 12, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

1. Thank you

2. We are even now arguing about the science. Yes evolution is taught in government schools here in the US too. Accuracy in the textbooks is a whole nother debate. Scientifically, a flat earth used to be considered fact. (Flat earth is not a biblical based idea)

3. Yes, evolution is a religion. Belief requires a leap of faith. There may be some compelling evidence that supports your interpretation but calling evolution a fact is quite a streatch. Yes, the American government sponsors Evolutioin. It is required that it be taught in public schools. Mandated. If you (teacher)refuse you will be fired. G Bush is not the American government, he is only the representative of the executive branch.

I love the pictures. Perhaps they represent a common creator ratherthan a common ancestor.

4.Agreed. Evolution within a species is identifyable. But where is evidence of anything slowly changing into something else?

BTW I love your accent.
 


Posts: 226 | Posted: 6:50 PM on January 12, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Scientifically, a flat earth used to be considered fact. (Flat earth is not a biblical based idea)

No, the idea that the earth was flat was not a scientific fact.  It was a perception that people held of how the earth was.  

Actually a lot of the great Greek philosophers thought the earth was a sphere - Pythagoras (6th century BC), Plato and Arisotle (4th century BC).  The sphere was considered the perfect form.  And they reasoned through logic and deduction - new stars appear as you travel south, the shadow of the earth is always curved upon the moon during lunar eclipse.  Eratosthenes even measure the circumference of the earth.  He was only off by about 5 to 10 percent.  Some early Greek thinkers even believed the earth orbited the sun.  Ah, those were great thinkers.  I love those ancient Greek philosophers.

But there are many passages in the Bible that show that the writers thought the earth was flat.  

Psalm 24:2, for example, it was said that "the world and all that is in it belong to the Lord; the earth and all who live on it are his. He built it on the deep waters beneath the earth and laid its foundations in the ocean depths,"

The earth rested on pillars, according to the Bible.  

Matthew 4:8, "The devil took him (Jesus) to a very high mountain and displayed before him all the kingdoms of the world in their magnificence...." The only plausible reason for the "very high mountain" was that the altitude would make it possible to see to the ends of the earth. Only on a flat earth would this be remotely possible,

There are quite a few other biblical passages that follow in the same way.  And there are other passages in the bible that put the earth as the unmoving center of the universe.

Why do you think the Catholic Church fought tooth and nail against such ideas?  Because they wanted to believe in the inerrancy of the Bible.  The Holy Bible!

The Greek philosophers were correct, while the Christians, who came later, were wrong.

Yes, evolution is a religion. Belief requires a leap of faith. There may be some compelling evidence that supports your interpretation but calling evolution a fact is quite a streatch.

Evolution is a fact.  You're too blinded by your desire to believe in an inerrant Bible to see it.

But where is evidence of anything slowly changing into something else?


Can I ask you a question - what do you think fossils are?  Look at the hominid fossil record.  Hominid species began branching off from a common ape ancestor about 8 million years ago.  Look at the fossil skulls.  I don't there there is much doubt that there is a clear transition to modern Man.  An evolution to our species.  And new fossils are being added every year.
 


Posts: 1460 | Posted: 11:52 PM on January 12, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Orion,

"No, the idea that the earth was flat was not a scientific fact.  It was a perception that people held of how the earth was.  "

I said that it was considered to be a fact - "a piece of information presented as being objective reality" - (merriam-webster 5.) At turned out to be a false assumption. The point is that the "scientific community" persecuted anyone with a differing opinion.

"The earth rested on pillars, according to the Bible. "

The earth does rest on pillars. They are called the natural laws. Physics, chemistry, etc. But could there be more natural laws than we currently percieve? How do these laws behave in other dimensions? perhaps we will know some day.


"There are quite a few other biblical passages that follow in the same way.  And there are other passages in the bible that put the earth as the unmoving center of the universe."

When using the bible to argue against its own legitimacy, you will never make headway unless you present your argument in context. Yes there are some difficult and seemingly contradictory passages. You could cherry pick them to support any argument, much the way an evolutionist will cherry pick a fact that supports his hypotheses. A true biblical scholar will always maintain the perspective of context and continuity.

"Evolution is a fact.  You're too blinded by your desire to believe in an inerrant Bible to see it."

Again, using the merriam-webster definition of fact that best supports this claim - N-" a piece of information presented as having objective reality" or "something that has actual existance or occurance". An objective reality is one that you can look at from any prespective and come to the same conclusion. Every argument you have given is subjective, as are mine.Thus, no concensus= no fact.


"But where is evidence of anything slowly changing into something else?"


"Can I ask you a question - what do you think fossils are?  Look at the hominid fossil record.  Hominid species began branching off from a common ape ancestor about 8 million years ago.  Look at the fossil skulls.  I don't there there is much doubt that there is a clear transition to modern Man.  An evolution to our species.  And new fossils are being added every year."

I recomend you read the book "Bones of Contention" which has never been refuted.

EntwickeInCollin (Ecoli for short, not intended as an insult)

"Scientific debate isn't conducted in the classroom. There are people who sleep through their 10th grade biology class and later claim that vaccines cause autism, but there's no question that they're wrong."

Science- knowledge or a system of knowledge covering general truths or the operation of general laws especially as observed and tested through scientific meathod.

Science is debated everywhere that knowledge is tested. Scientific meathod is a systematic approach but not necessarily the only approach.

"The agenda for creationism is quite clearly to establish theocracy. In a document entitled the Wedge Strategy, the Discovery Institute, the chief think tank behind creationism, intelligent design, and "academic freedom," specifically outlines the goal of pushing alternatives to evolution. They are twofold:"

* "To defeat scientific materialism and its destructive moral, cultural, and political legacies"

* "To replace materialistic explanations with the theistic understanding that nature and human beings are created by God"

And what is the agenda for evolutionists? Humanism? And what is wrong with moral absolutes? The US, arguably the greatest nation the world has ever seen, was formed almost entirely by Christian men on the principal of individual self government and absolute biblical moral authority. The very fabric of our once great republic is being ripped apart by secular humanism and "me first" mentality. Yes I feel an obligation to fight this by whatever means necessary WITHIN THE FRAMEWORK OF CHRISTIAN MORALITY. The enemies of our nation aren't so bound.

"I don't mean to sound rude, but it doesn't look like you know what you're talking about here. What exactly do you mean "evolution is not identifiable"? You seem to be attaching criticism to evolution without understanding how evolution operates as a concept in science."

Evolution of a species - increased genetic information - is nonexistant. Ask Richard Dawkins to give you one example of mutation resulting in an increase of information. An a molecular level evolution becomes a mathamatical impossibility. Even the simplest form of life could not function without all of its complex parts working together in harmony. If it could be reverse engineered even in theory to demonstrate the functionality of a lesser molecule dont you think Dawkins and his ilk would be spouting it fromthe rooftops?

All I here from you gentlemen is "it's a fact" but I see no objective emperical evidence.

I have never claimed that creation is a fact. I only claim that the facts support a creator rather than whatever it is you believe in.

The problem with the 16 deductions you listed is that they were formed with the presuposition that evolution is real. I can use the very same deductions presupposing a creator and test them to find them true.
The shortest one is #14
Deduction 14: If there is a unity of life based on a common CREATOR, this should be reflected in the structure of cells.
Cells do indeed share a similar structure as do many multicelled organisms. I deduce a common design which is much more likely than random occurance. Or did all life come from a single molecule? Could similar molecules have randomly developed independant of one another?


"This is not surprising. A reliance on evidence to form your beliefs is not a part of your worldview. You are not a scientist and clearly do not understand or value scientific thought."

This sentance accurately describes your entire argument. Look up the definition of religion and let me know how belief in evolution is not a religion?









 


Posts: 226 | Posted: 12:06 PM on January 13, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

The US, arguably the greatest nation the world has ever seen, was formed almost entirely by Christian men on the principal of individual self government and absolute biblical moral authority.

Actually, many of the founding fathers of the US did not hold particularly strong Christian beliefs.  A number of them were strongly opposed to organized religion.  Some were deists.  Washington, John Adams, Jefferson, Franklin, Thomas Paine, Madison.  None of these men held strong Christian beliefs.  The US Constitution actually explicitly says that there should be a seperation of church and state.  

Evolution is not a religion.  

Let me ask you something.  Why do you think ID, or creationism, should be taught in public schools in the biology class?  Why do you consider creationism science?  Do you think astrology and alchemy should also be taught as an alternative to astronomy and chemistry?  If not, why not?

Do you understand what the scientific method is, and how it works?  From what you have said in previous posts, you certainly don't indicate that you have a clue to how science works.  You seem to imply that any idea qualifies as a scientific theory.  Do you really know what a scientific theory is, and how it differs from the layman's use of the word?


 


Posts: 1460 | Posted: 1:10 PM on January 13, 2009 | IP
Aswissrole

|      |       Report Post




Member
Post Score
Adjustment:
n/a

Rate this post:

From what you are saying there seems to be almost two contrasting points in the creationist argument:

1) Evolution is not completly proven and therefor it is not accurate.
Firslty, it is proven but for something to be proven to the state which creations demand seems a somewhat impossible task. Yes, old theories have been proven wrong, but they are replaced with newer and more acurate theories. This is how science is supperia to religion.

2) Just trust the Bible
This seems to completly contridict the first argument.



"Do you really know what a scientific theory is, and how it differs from the layman's use of the word?"
A very good point made by Orion. You must remember that gravity is still a "theory" along with Newtons laws of motion and General Relativity.

Can someone please tell me how to use the quote function!

(Edited by Aswissrole 1/13/2009 at 1:48 PM).
 


Posts: 69 | Posted: 1:47 PM on January 13, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Orion,

I admitt that the topic of Americas Christian heratige belongs on another debate forum. However you have either intentionally or inadvertantly mis-represented the constitutional stance on religion. And that does have some bearing on this debate.

First, you erroniously state "The US Constitution actually explicitly says that there should be a seperation of church and state."  

The constitution actually says "Congress shall make no law respecting the ESTABLISHMENT of a religion nor the rerstriction thereof."

Government schools requiring evolution to be taught is a violation of this clause as evolution fits the definition of a religion.
The "wall of seperation" quote  was in a letter written by Thomas Jefferson advising against the state of Virginia funding a particular denomination with public money.It appears in NO law in this land.


"Evolution is not a religion."
From merrium-webster, religion is:

1 a: the state of a religious b (1): the service and worship of God or the supernatural (2): commitment or devotion to religious faith or observance
2: a personal set or institutionalized system of religious attitudes, beliefs, and practices
3archaic : scrupulous conformity : conscientiousness
4: a cause, principle, or system of beliefs held to with ardor and faith
— re·li·gion·less adjective

I believe you fit in to #4 quite snugly.

I actually typed out the definition of science and scientific theory on my previous post. It would be logical to assume that since I used the dictionary definition in an argument that I do in fact understand the words I wrote.

Orion, you demean your argument when you resort to unsupported personal attacks through the use of sarcasim.



 


Posts: 226 | Posted: 1:55 PM on January 13, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

from Wikipedia: (and Jefferson wrote the Constitution)

Separation of church and state is a political and legal doctrine that government and religious institutions are to be kept separate and independent from each other.[1] The term most often refers to the combination of two principles: secularity of government and freedom of religious exercise.[2]

The phrase separation of church and state is generally traced to the letter written by Thomas Jefferson in 1802 to the Danbury Baptists, in which he referred to the First Amendment to the United States Constitution as creating a "wall of separation" between church and state.[3] The phrase was then quoted by the United States Supreme Court first in 1878,[4] and then in a series of cases starting in 1948.[5] This led to increased popular and political discussion of the concept.

It's one of the main reasons why the courts have kept Creationism out of the public schools.  Creationism pushes Christion religious beliefs.  Keep it in the church where it belongs.

I can see why Creationists are annoyed and think its a double standard.  But I ask you, does science push the teaching of evolution in your church?  I hardly think so.

There is a difference between evolution and creationism.  Creationism has no basis in the real world.  It has its sole support from a book that is full of myths - myths that some people believe to be actually true!

Evolution is based on facts that we can observe and measure.  More importantly, the theory of evolution successfully explains the history of life on earth, and it continues to make succcessful predictions (as EntwickelnCollin has pointed out).  Until some other theory comes along that does a better job at explaining what we see, evolution is it.  That is something that Creationism can never do.

What you say regarding 'evolution is a religion' is nonsense.  That sounds more like an attempt to say "Hey look - evolution is a religion.  So the courts should disallow it from being taught in schools too".  You're weaselling out of the discusssion of the evidence presented that evolution is a fact.

It's like someone who believes the earth is flat, - that it says so in the Bible.  I say, no - that's incorrect.  We have proof that the earth is actually spherical.  See this and that.

The flat earth supporter ignores the evidence presented to hiim and says "Your spherical earth belief is merely a religion.  There's no truth to it."

That's exactly the way you sound.  You ignore the evidence.  You don't even discuss it.  Meanwhile you rely on believing in some stories that were writeen 2,000 years ago that are sheer fantasy.  In fact, some of these stories (such as the Flood) are borrowed stories from other cultures.  They're not even genuine to the Bible!  

Why are stories about floods so prevalent?  Because the major civilizations originated near rivers.  Rivers flood all the time.  Stories get told about the Great Flood of such and such.  The stories reach mythic proportions over time.  

I find it absolutely astonishing that people in this day and age believe in those biblical myths.  

But then some people probably think - well, if the stories in Genesis are not true, then how can we trust anything else in the Bible to be  true?  And that's the delenma they find themselves in.  So they ignore reason and swallow the whole mythology - hook, line, and sinker.




 


Posts: 1460 | Posted: 3:33 PM on January 13, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

"from Wikipedia: (and Jefferson wrote the Constitution)"

Actually a guy named Morris wrote the constitution. Jefferson wasn't even there at the constitutional convention.

"There is a difference between evolution and creationism.  Creationism has no basis in the real world.  It has its sole support from a book that is full of myths - myths that some people believe to be actually true!"

Could the "real world" consist of more than what is currently known? What do you know about other dimensions? Scientists admit to 10 to 34 such dimensions. Could God exist in one of them? If so, could He possibly transcend more than one?

Relagating something you know very little about to myth is denying the possibility of anything beyond what you personally know. I think you are probably quite intelligent. Maybe you even know half of everything. Could God exist in the other half? To deny even the possibility takes quite a bit of faith in your own intelect.

"What you say regarding 'evolution is a religion' is nonsense. "

Please explain in light of the dictionary definition of religion (something more reliable than wiccapedia please.)

"That's exactly the way you sound.  You ignore the evidence.  You don't even discuss it."

Please submitt some actual evidence. I have seen only conjecture so far. I admit I can give no evidence for God outside of my own personal experience and the testimony of countless others who believe as I do, but I see no other possibility for the amazing complexity of life other than intelligent design.

Where is one irrefutable fact that evolution is more than conjecture? You seem to have more confidence in its existance than even the most highly regarded astrophysycists and microbiologists. Everything I've read about recent discoveries and high leved experiments seems to have some referance to "coming closer to solving the troubling inconsistancies in evolutionary theory".
( I read a similar quote sometime in the last few days about some major ongoing experiment in a press release. I'll try and find the source for you as you may find the thing as interesting as I do)

 


Posts: 226 | Posted: 4:25 PM on January 13, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Yes, I'd be interested in seeing that article.
 


Posts: 1460 | Posted: 4:49 PM on January 13, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

OK - I stand corrected on who wrote the Constitution.  :0)

Gouverneur Morris of Pennsylvania was put in charge of the committee to draft the final copy of the Constitution. Other men who had much to do with writing the Constitution included John Dickinson, Gouverneur Morris, Thomas Jefferson, John Adams, Thomas Paine, Edmund Randolph, James Madison, Roger Sherman, James Wilson, and George Wythe. Morris was given the task of putting all the convention's resolutions and decisions into polished form. Morris actually "wrote" the Constitution. The original copy of the document is preserved in the National Archives Building in Washington, D.C.
 


Posts: 1460 | Posted: 4:58 PM on January 13, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

2. If the argument ended 100 years ago, than why are we still debating? I'd wager that all four of us in this thread right now have a nearly identical public education.


"Scientific debate isn't conducted in the classroom. There are people who sleep through their 10th grade biology class and later claim that vaccines cause autism, but there's no question that they're wrong."


Science- knowledge or a system of knowledge covering general truths or the operation of general laws especially as observed and tested through scientific meathod.

Science is debated everywhere that knowledge is tested. Scientific meathod is a systematic approach but not necessarily the only approach.


This does not address what I said. You’re making the claim that because someone (literally anyone, no matter how uneducated in science they may be) disagrees with a proposition made in science, it should not be accepted as fact within the scientific community. It is not difficult see how invalid that argument is. There are people who disagree with science in almost every way: psychics, alchemists, astrologists, priests, etc. These individuals make claims about reality that are demonstrably false. Mere disagreement is not an accurate indication of a scientific proposition’s factual status.

You make another strange statement about “fact” when talking with Orion:


Again, using the merriam-webster definition of fact that best supports this claim - N-" a piece of information presented as having objective reality" or "something that has actual existance or occurance". An objective reality is one that you can look at from any prespective and come to the same conclusion.


We can see here than your argument rests on several faulty premises. The last sentence in the quote above is not necessarily true. It actually requires a very specific perspective to come to accurate conclusions about objective reality. If someone looks at the world from a faith-based perspective, they certainly are not going to come to the same conclusions as someone who looks at the world from an evidence-based perspective. Only the evidence-based perspective is relevant if one is going to make claims about evidence itself.


Every argument you have given is subjective, as are mine.Thus, no concensus= no fact.


And finally we arrive at the implications of your argument, which are frighteningly harmful to scientific process. If your claim is correct, then we should be able to agree with the “fact” that the earth is round from every perspective. But what about individuals who look at the world from the “perspective” that the earth is flat? If your claim is correct, just the possible existence of someone who looks at the world from a flat-Earth perspective automatically invalidates a round Earth from ever being considered a fact in the scientific community, no matter how much evidence, testing, and time has proven the proposition correct.

In other words, your idea of “fact” is meaningless. From your standpoint of “fact,” facts are by definition impossible to attain; nothing can be called a fact. Exactly what, then, is the relevance of saying that evolution cannot be called a fact? That statement loses its rhetorical weight when the obvious roundness of the earth or the obvious existence of gravity cannot be called facts either.


3. The agenda for creationists is a little bit of equality. We ask only to present an alternative viewpoint to the government sponsored RELIGION called evolution.


"The agenda for creationism is quite clearly to establish theocracy. In a document entitled the Wedge Strategy, the Discovery Institute, the chief think tank behind creationism, intelligent design, and "academic freedom," specifically outlines the goal of pushing alternatives to evolution. They are twofold:"

* "To defeat scientific materialism and its destructive moral, cultural, and political legacies"

* "To replace materialistic explanations with the theistic understanding that nature and human beings are created by God"


And what is the agenda for evolutionists?


Woah there, timbrx. From here on out, I would really appreciate it if we could keep each discussion in progress limited to the points raised in that specific discussion. If you want to talk about an evolutionist agenda, feel free to bring it up as a different point. I’m confident you can understand that accusing evolutionists of having their own agenda does not defend your original claim that creationists do not have a theocratic agenda in pushing their ideals in the science classroom, and neither does justifying that theocratic agenda. We’ll touch on the motivations behind teaching evolution in science classes in a moment, but for now I need you to stick to creationism. After having the Wedge Strategy explained to you, do you admit or still deny that creationism has theocratic motivations behind their seemingly innocent attempt to express “academic freedom”?

Anyway, because I have nothing from you to work with on the creationist side of this discussion, we’ll continue on to evolutionists to keep things rolling:


And what is the agenda for evolutionists? Humanism?


The short answer to your question is “No.” The agenda behind teaching evolution in a class about biology is to teach biology.


And what is wrong with moral absolutes?


I never said anything is necessarily wrong with moral absolutes, now did I, timbrx? Whether or not moral absolutes are a good thing is not the point. The point is that teaching moral absolutes should not be the motivation in wanting something taught in a science classroom. Evolution is a subject of scientific inquiry, but moral absolutes are not. Even though teaching algebra is a good thing to do, a biology classroom would not be the proper place to introduce a subject like algebra.


The US, arguably the greatest nation the world has ever seen, was formed almost entirely by Christian men on the principal of individual self government and absolute biblical moral authority. The very fabric of our once great republic is being ripped apart by secular humanism and "me first" mentality. Yes I feel an obligation to fight this by whatever means necessary WITHIN THE FRAMEWORK OF CHRISTIAN MORALITY. The enemies of our nation aren't so bound.


That’s nice, but I’m sorry – a class on science is not the proper place to teach Christian morality.

Moving on again…


"I don't mean to sound rude, but it doesn't look like you know what you're talking about here. What exactly do you mean "evolution is not identifiable"? You seem to be attaching criticism to evolution without understanding how evolution operates as a concept in science."


Evolution of a species - increased genetic information - is nonexistant.


Demonstrably false. See the following:


* increased genetic variety in a population:

-Lenski, R. E., 1995. Evolution in experimental populations of bacteria. In: Population Genetics of Bacteria, Society for General Microbiology, Symposium 52, S. Baumberg et al., eds., Cambridge, UK: Cambridge University Press, pp. 193-215.

-Lenski, R. E., M. R. Rose, S. C. Simpson and S. C. Tadler, 1991. Long-term experimental evolution in Escherichia coli. I. Adaptation and divergence during 2,000 generations. American Naturalist 138: 1315-1341.


* increased genetic material:

-Alves, M. J., M. M. Coelho and M. J. Collares-Pereira, 2001. Evolution in action through hybridisation and polyploidy in an Iberian freshwater fish: a genetic review. Genetica 111(1-3): 375-385.

-Brown, C. J., K. M. Todd and R. F. Rosenzweig, 1998. Multiple duplications of yeast hexose transport genes in response to selection in a glucose-limited environment. Molecular Biology and Evolution 15(8): 931-942. http://mbe.oupjournals.org/cgi/reprint/15/8/931.pdf

- Hughes, A. L. and R. Friedman, 2003. Parallel evolution by gene duplication in the genomes of two unicellular fungi. Genome Research 13(5): 794-799.

- Ohta, T., 2003. Evolution by gene duplication revisited: differentiation of regulatory elements versus proteins. Genetica 118(2-3): 209-216.


* novel genetic material:

- Knox et al. 1996;

- Park, I.-S., C.-H. Lin and C. T. Walsh, 1996. Gain of D-alanyl-D-lactate or D-lactyl-D-alanine synthetase activities in three active-site mutants of the Escherichia coli D-alanyl-D-alanine ligase B. Biochemistry 35: 10464-10471.


* novel genetically-regulated abilities:

- Prijambada, I. D., S. Negoro, T. Yomo and I. Urabe, 1995. Emergence of nylon oligomer degradation enzymes in Pseudomonas aeruginosa PAO through experimental evolution. Applied and Environmental Microbiology 61(5): 2020-2022.

___

The only way these observed instances could not count as an increase in “genetic information” is if you define “genetic information” to mean something other than an appearance of new genetic material, in which case the definition is moot.

A useful mechanism for “adding information” is gene duplication. Gene duplication occurs when a long stretch of DNA is copied. Once the duplication has occurred, mutations that change one or both of the copies is an inevitability. And this is not simply conjecture. The study of genetic sequencing has shown several instances of gene duplication + mutation. Below are some examples:


* Two enzymes in the histidine biosynthesis pathway that are barrel-shaped, structural and sequence evidence suggests, were formed via gene duplication and fusion of two half-barrel ancestors:

- (Lang, D. et al., 2000. Structural evidence for evolution of the beta/alpha barrel scaffold by gene duplication and fusion. Science 289: 1546-1550. See also Miles, E. W. and D. R. Davies, 2000. On the ancestry of barrels. Science 289: 1490.)


* RNASE1, a gene for a pancreatic enzyme, was duplicated, and in langur monkeys one of the copies mutated into RNASE1B, which works better in the more acidic small intestine of the langur:

- Zhang, J., Y.-P. Zhang and H. F. Rosenberg, 2002. Adaptive evolution of a duplicated pancreatic ribonuclease gene in a leaf-eating monkey. Nature Genetics 30: 411-415. See also: Univ. of Michigan, 2002, How gene duplication helps in adapting to changing environments. http://www.umich.edu/~newsinfo/Releases/2002/Feb02/r022802b.html


* Yeast was put in a medium with very little sugar. After 450 generations, hexose transport genes had duplicated several times, and some of the duplicated versions had mutated further:

Brown, C. J., K. M. Todd and R. F. Rosenzweig, 1998. Multiple duplications of yeast hexose transport genes in response to selection in a glucose-limited environment. Molecular Biology and Evolution 15(8): 931-942. http://mbe.oupjournals.org/cgi/reprint/15/8/931.pdf

___

Don’t feel forced to stop there, though. There are countless examples of “increased genetic information” available for you to read up on in biological literature. Try starting with a PubMed search for “gene duplication”, and you’ll find more than 3000 references.

The main problem I see with the claim that mutations cannot produce additional genetic information is that it is pure semantics and does not have any basis in logic or reality. It’s like saying, “Gravity can’t be real because ketchup is red.” It’s not exactly logical that we can see evolution happening in bacteria due to increased variance, and then go back and say that such increased genetic variance is impossible a priori. Any questions?


Ask Richard Dawkins to give you one example of mutation resulting in an increase of information.


I don’t have to, for Richard Dawkins has written several books about genetics and evolution. During a home interview, some creationists were allowed into his house under the premise that they were there to talk about a subject other than creationist arguments for evolution. When they brought up the creationist canard of “no increase in genetic information”, Dawkins sat in front of the camera trying to determine how he was going to deal with a dishonest group of people standing in the middle of his house after he had specifically allowed them to come in.

Apparently, that event is supposed to be evidence that helps your position in this argument, but I can’t see how it does.


An a molecular level evolution becomes a mathamatical impossibility.


Hm… Well, this is what I have to say about that: It’s impossible that it’s a mathematical impossibility if we can watch a culture of bacteria evolve to become resistant to antibiotics. I’m sure you’ve heard of the term “microevolution,” and I’m going to assume you accept that it happens. So here’s the problem: Microevolution disproves the claim you just made above.


Even the simplest form of life could not function without all of its complex parts working together in harmony.


What complex parts? The simplest forms of life we see today are not nearly as simple as the first organisms. Self-replicators, all that is required for evolution to begin, can be incredibly simple -- as simple as a strand of just six DNA nucleotides. That’s simple enough to form via prebiotic chemistry! (See Sievers, D. and G. von Kiedrowski. 1994. Self-replication of complementary nucleotide-based oligomers. Nature 369: 221-224.)

If it could be reverse engineered even in theory to demonstrate the functionality of a lesser molecule dont you think Dawkins and his ilk would be spouting it fromthe rooftops?


As I just demonstrated, even the simplest forms of life can be reverse-engineered, and not just in theory, either. I think what you have to say next is very revealing of your position:

All I here from you gentlemen is "it's a fact" but I see no objective emperical evidence.


This is because it’s very exhausting to do simple research for you, timbrx. You’re not the first one to say “evolution is not a fact” or “there is very little evidence for evolution.” You won’t be the last, either, and it’s extremely tiring to explain the same pile of evidence over and over and over again. You have the ability to research this information by yourself, and the fact that you refuse to research it yourself only shows that you aren’t genuinely interested in the subject and that you’ve made your mind up already, without actually looking at the evidence.

Moving on again…


Evolution is indeed testable. Here is a list of testable predictions made by evolution from John A. Moore's book Science as a Way of Knowing: The Foundations of Modern Biology:


The problem with the 16 deductions you listed is that they were formed with the presuposition that evolution is real.


Timbrx, the list of 16 deductions is supposed to presuppose that evolution is real. They’re falsifiable, testable predictions. The whole idea is that if evolution is true, we should observe the things that we observe. These deductions also mean that if we observe something opposite of these 16 deductions, then evolution is not true.

Do you understand now? You challenged us to explain how evolution is testable, and I showed you. Your criticism does not address that issue.


I can use the very same deductions presupposing a creator and test them to find them true.
The shortest one is #14
Deduction 14: If there is a unity of life based on a common CREATOR, this should be reflected in the structure of cells.


That’s good insight, timbrx. Unfortunately, it’s not necessarily true nor particularly helpful. Evolution requires that unity of life be reflected in the structure of cells, but a common creator hypothesis does not. It’s not possible for something to evolve from something else and have literally no cellular similarities. But it is possible for a being to design two different things made of completely different substances.

More importantly, however, is this: Your ability to turn Deduction 14 around and try to make a prediction that we can test for creationism does not refute the proposition that evolution is testable. Please try to stay on topic.


"This is not surprising. A reliance on evidence to form your beliefs is not a part of your worldview. You are not a scientist and clearly do not understand or value scientific thought."


This sentance accurately describes your entire argument.


After having a chance to read up on much of the evidence that I have considered in my acceptance of evolution, now would be the appropriate time to rethink that statement, timbrx.


Look up the definition of religion and let me know how belief in evolution is not a religion?


I’m frankly flabbergasted that you’re still trying to win this one. I suppose I’ll play your game, though. This is the definition of religion that you have supplied:

1 a: the state of a religious b (1): the service and worship of God or the supernatural (2): commitment or devotion to religious faith or observance
2: a personal set or institutionalized system of religious attitudes, beliefs, and practices
3archaic : scrupulous conformity : conscientiousness
4: a cause, principle, or system of beliefs held to with ardor and faith
— re•li•gion•less adjective


You believe that definition #4 fits evolution “quite snugly.” In response, I ask you this: Why? Are you trying to tell us that we treat evolution like a religion because we use faith to come to our conclusions? Realizing that faith is a belief in something for which there is no evidence, this can’t possibly describe our acceptance of evolution.

Perhaps, then, you mean to say we treat evolution like a religion simply because we hold to our acceptance of evolution with “ardor”? It’s true that I’m passionate about protecting evolution’s status in the education system, but I’m passionate about a lot of things, and I don’t think in all fairness that “ardor” is enough to place our acceptance of evolution on the same religious platform as something like Christianity.

If you go by definition #4, then you could say anything one is passionate about counts as a religion, in which case you’re not only a Christian, but a member of many religions, be it playing a musical instrument, working at your job, loving a partner, loving your family, eating food… The list goes on.

In sum, definition #4 is the weakest and most broad way of classifying religion. I don’t think you mean to say evolutionists are merely passionate about their acceptance of the Theory of Evolution. You’re trying to put creationism and evolution on the same faith-based field, and when it comes to that attempt, timbrx, you have failed.


That’s all I have for now. Thanks for reading.









(Edited by EntwickelnCollin 1/14/2009 at 2:08 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 7:09 PM on January 13, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Very well put Entwick!!!   I wish I had half the ability you have in explaining concepts so eloquently.  Thank you.
 


Posts: 1460 | Posted: 8:35 PM on January 13, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Entwick,

Thanks for the homework. Sorry to bore you with my ignorance. I will study your footnotes though I certainly won't read every book. After all, how long can I be expected to stay away?

However I would like to address a few of your points:
1. "this does not address...
Actually, it does. Science is not absolute. It is constantly "evolving" and " knowledge can be observed and tested" in the classroom, the laboratory or anywhere else that thinking people strive to better understand the world.

If you don't like the definition of science, take it up with the webster people.

2. " you make another strange statement..."
I agree the part about "any perspective" is a little weak. The meaning I was attempting to imply is that you and I disagree on origons but we both accept 1+1=2 as a fact. We have a different perspective on the origin of math but draw the same conclusion. This can be said about virtually every "fact" however I concede that some people won't accept a fact even if it hits them on the head. But that doesn't mean that if an evolutionist calls it a fact it necessarily is.
3. I applaud you for the masterful way in which you take something I didn't say and turn it into a ridiculous statement.
Perhaps "any rational perspective with a desire for objectivity" would be more appropriate. The whole guiding premesis behind science is to gain a better understanding and increase knowledge. To streach what I did say into somehow meaning facts cannoy be facts is perhaps a bit disingenuous. Do you really think if I said "no, 1+1=3" that I would necessarily believe that now 1+1=2 is no longer true? I'm not insane, I assure you. (At least I don't think I am. ;)

4. "woah there timbrx..." Actually that is a fair question since I've never even heard of the wedge strategy. I was simply trying to establish that we all have an agenda. But yes, I will admit that some elements within the creationist community have "theocratic" motivations. But what is your point? Maybe they believe it is for the good. Maybe not, I don't know. I can understand your reservations about such a group, because I have my own reservations about the motivation behind the "kill God" element within evolutionist ranks. None of us are truely innocent. I have a motivation for being in this forum. If I believe something I should be equipped to defend it. Not to try and change you. But to try and reinforce me.

5. I will cede the morality thing to you. My point was just that evolution supports secular humanism which denies moral absolutes. I see this as destructive.

See you when I finish my homework, professor.


 


Posts: 226 | Posted: 01:54 AM on January 14, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

If you don't like the definition of science, take it up with the webster people.

When discussing science, forget about a standard dictionary and use a science dictionsry, you won't make as many mistakes...
 


Posts: 1664 | Posted: 03:53 AM on January 16, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Entwick,

There are countless examples of “increased genetic information” available for you to read up on in biological literature. Try starting with a PubMed search for “gene duplication”, and you’ll find more than 3000 references.


By increase in information, we certainly don't mean something like duplication -all that is, is more of the same, nothing different.
What we need to do is account for a liver or a kidney from no liver or kidney in a genetic so-called ancestor. That means vast amounts of not only information for new organs but the information has to be coordinated within itself and with the rest of the organism's already existing organs.
Complex co-ordinated new information that codes for something original -that's what is required. We need to know that it is possible for a leg or a liver to come about via random genetic copying mistakes.

After having the Wedge Strategy explained to you, do you admit or still deny that creationism has theocratic motivations behind their seemingly innocent attempt to express “academic freedom”?


What exactly do you mean by theocratic motivations? Does that mean that they would like to allow for the possibility that God or an intelligent designer may have had something to do with us being here or do you imagine that theists are going to be forcing God possibilities down unwilling throats (like evolutionists currently do with evolution only, no other possibility allowed)?




-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 09:49 AM on January 16, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Hello, Lester. Thanks for reading.

By increase in information, we certainly don't mean something like duplication -all that is, is more of the same, nothing different.


I think you could benefit from reading everything I say, Lester.

Here's what I said. I've highlighted the point you missed:

A useful mechanism for “adding information” is gene duplication. Gene duplication occurs when a long stretch of DNA is copied. Once the duplication has occurred, mutations that change one or both of the copies is an inevitability. And this is not simply conjecture. The study of genetic sequencing has shown several instances of gene duplication + mutation. Below are some examples:


I'm going to reiterate that here: It's duplication, and then mutation. A mutated duplicate ceases to be a duplicate.

What we need to do is account for a liver or a kidney from no liver or kidney in a genetic so-called ancestor.


In fact, we don't need to account for that if all we're talking about is the ability for genomes to increase their information. A single nucleotide of DNA can be duplicated and then mutated, and that would be an example of increased information. If you disagree, please explain to me why the following process of duplication + mutation does not account for increased information:

Sequence A:

AATGACTGCAACTGATAGCT

Sequence B (duplicate):

AATGACTGCAACTGATAGCT

Sequence B (mutant):

AATGACTGCAACTGATAGAT

No organ formations necessary, Lester. As I've shown with the multiple cited examples, increased genetic information can be seen when the variety within a simple population of bacteria increases, among other changes. I'd be interested to see what you have to say about these examples.

That means vast amounts of not only information for new organs but the information has to be coordinated within itself and with the rest of the organism's already existing organs.


It seems that what you're asking for is a single genetic change that will give an organism a whole new organ. Evolution does not predict that this will happen, or that it is even possible, so a lack of evidence towards this phenomenon is irrelevant. Whether or not organs themselves are irreducibly complex is another issue (a moot one as well, of course).

Complex co-ordinated new information that codes for something original -that's what is required. We need to know that it is possible for a leg or a liver to come about via random genetic copying mistakes.


We do know. Name an organ and I could waste some more of my time explaining to you information that is amply available on the internet.  

What exactly do you mean by theocratic motivations?


Again, Lester: It helps to read what I say before responding to it (I'm not trying to smarmy -- I'm just saying it will help). Here's what I explained to timbrx about the Wedge Strategy:

The agenda for creationism is quite clearly to establish theocracy. In a document entitled the Wedge Strategy, the Discovery Institute, the chief think tank behind creationism, intelligent design, and "academic freedom," specifically outlines the goal of pushing alternatives to evolution. They are twofold:

* "To defeat scientific materialism and its destructive moral, cultural, and political legacies"

* "To replace materialistic explanations with the theistic understanding that nature and human beings are created by God"


So, to answer your question, I mean those theocratic motivations.

Does that mean that they would like to allow for the possibility that God or an intelligent designer may have had something to do with us being here


They certainly would like that, but the reason they would like that is unconstitutional and blatantly unscientific, as you can see from the two goals outlined above in bold.

or do you imagine that theists are going to be forcing God possibilities down unwilling throats


As you can see, that's what they eventually want the ability to do. Fortunately ID/Creationism is a see-through ploy that has been struck down by the federal courts. The pseudo "academic freedom" movement will suffer the same fate.

(like evolutionists currently do with evolution only, no other possibility allowed)?


Unless or until other scientific explanations for the diversity of life on planet Earth are discovered, the only scientific explanation that exists will remain the only scientific explanation that is taught in schools. I'm not sure why you have a problem with that anymore than you do with gravity being taught as the only force of attraction in a Newtonian physics class.









(Edited by EntwickelnCollin 1/16/2009 at 6:55 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 6:52 PM on January 16, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

EntwicelnCollin,

Sequence A:

AATGACTGCAACTGATAGCT

Sequence B (duplicate):

AATGACTGCAACTGATAGCT

Sequence B (mutant):

AATGACTGCAACTGATAGAT


I see only a change in information, not an increase. The mutated strand still has 20 codes in sequence. It will now duplicate itself and pass that information on to the new cell. But it doesn't add a whole strand to the gene code.

Do you have an example where the information in a nucleotide has increased in quantity? from 20 codes to say 22? Now that would be exciting. Especially if it represented a cell viable in a natural environment.

(Edited by timbrx 1/17/2009 at 2:54 PM).
 


Posts: 226 | Posted: 12:08 AM on January 17, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

By the way Ecoli, I recognised the above sequence as coming from the yeast experiment involving 450 generations. Oxford journals article.
 


Posts: 226 | Posted: 12:24 AM on January 17, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Quote from timbrx at 12:24 AM on January 17, 2009 :
By the way Ecoli, I recognised the above sequence as coming from the yeast experiment involving 450 generations. Oxford journals article.


Well, that's weird -- like, really weird. I made the sequence up to use it as an example. lol

I see only a change in information, not an increase. The mutated strand still has 20 codes in sequence.


Sure, but now instead of 20 nucleotides, we have 40 nucleotides. And instead of 20 nucleotides with identical duplicates, we have an entirely new strand of DNA that codes for something completely different.

It will now duplicate itself and pass that information on to the new cell. But it doesn't add a whole strand to the gene code.


What do you mean? Before we had just "AATGACTGCAACTGATAGCT." Now we have "AATGACTGCAACTGATAGCTAATGACTGCAACTGATAGAT."

Do you have an example where the information in a nucleotide has increased in quantity? from 20 codes to say 22? Now that would be exciting. Especially if it represented a cell viable in a natural environment.


Do you realize what you're asking for is actually less complex than a sequence of DNA that was duplicated and then mutated?

Try this one. It's actually quite simple:

We start with the sequence TCG, and the guanine nucleotide is duplicated. Now we have TCGG. Is that not an increase in information? It's even more of an increase if the rest of the sequence is then mutated. Where before we had just TCG, several generations later we could have something as different as ATTCAG. The T was duplicated twice; one of them mutated to A. The G was duplicated once, and the original G nucleotide mutated to A. Several very simple steps, really, and now the sequence codes for something very different than the original TCG.






One more thing: I'm sorry to point out that the strange twist in format is your fault. :p Please review your post, timbrx, and correct the quoting HTML to reduce the length of the page.

Thanks for reading.







(Edited by EntwickelnCollin 1/17/2009 at 01:03 AM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 12:56 AM on January 17, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Hi Entwick,

I'm going to reiterate that here: It's duplication, and then mutation. A mutated duplicate ceases to be a duplicate.


Thanks for clarifying Entwick but I did read and see what you were getting at. The only problem is - do you get new information by mutating a duplicate or do you actually get a mutated protein that may or may not have a negative effect depending, I suspect, on how it folds up when its' sequence is no longer the same and it still has a specific job to do in combination with other non-mutated proteins?

My best reference books on the topic of what mutations do and do not do in practical terms are John Sanford's "Genetic Entropy", Lee Spetner's "Not By Chance" and Werner Gitt's  writings about information -what it is and what it is not.

Imagining that mutations increase information is not the same as demonstrating that they are capable of any such thing. The actual evidence seems to show that mutations really don't help any situation, it is a devolution, not an evolution thing that happens when mutation comes into play.

I understand that evolution requires that mutations and natural selection can do wonderful uplifting things -but -the question I always like to ask myself is - is it true?

It seems that what you're asking for is a single genetic change that will give an organism a whole new organ.


No I don't ask for that but I must insist that a load of related and useful mutations pull together in a co-ordinated fashion to produce some new and original organ -quite a tall order considering that mutations are spelling mistakes for all intents and purposes. One does not write a useful essay by taking somebody else's working essay and copying it with random spelling mistakes here and there and then hoping that by choosing the best spelling mistakes, a whole new and more interesting story will develop in time. Information doesn't work like that. Information only ever comes from intelligence, there is nothing random about it.

"To defeat scientific materialism and its destructive moral, cultural, and political legacies"


I think what you're not quite getting here is that we truelly believe that the scientific evidence supports an intelligent designer called God. There are only two possibilities -we were created  or everything created itself.
But I think ultimately, fear not, Christianity is not going to be forced like evolution is currently. However, the evidence for both viewpoints should be held up to the light to see which one makes more sense. We reject evolution as God and have good reason for doing so. The moral implications of evolution being preached as truth are already everywhere -time to fix it.

"To replace materialistic explanations with the theistic understanding that nature and human beings are created by God"


There will always be many people that run from God but both  options can be offered up to children and young adults for inspection. I don't agree that it will be possible to replace materialism but on the other hand I don't see why academic freedom shouldn't come into play so that everyone gets to see both sides of the argument rather than your side only.




-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 01:22 AM on January 17, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Entwick,
thanks for the heads up, quote box corrected.

Well, that's weird -- like, really weird. I made the sequence up to use it as an example. lol



from
. http://mbe.oupjournals.org/cgi/reprint/15/8/931.pdf

that is either really wierd or your mind has a retention ability far beyond your understanding.

as to the 20/22, I thought we were talking about the RNA strand only. My mistake, but same point.

We start with the sequence TCG, and the guanine nucleotide is duplicated. Now we have TCGG. Is that not an increase in information? It's even more of an increase if the rest of the sequence is then mutated. Where before we had just TCG, several generations later we could have something as different as ATTCAG. The T was duplicated twice; one of them mutated to A. The G was duplicated once, and the original G nucleotide mutated to A. Several very simple steps, really, and now the sequence codes for something very different than the original TCG.



now this is what I am asking for. Did you make this one up or is it an actual example?
 


Posts: 226 | Posted: 3:03 PM on January 17, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Imagining that mutations increase information is not the same as demonstrating that they are capable of any such thing. The actual evidence seems to show that mutations really don't help any situation, it is a devolution, not an evolution thing that happens when mutation comes into play.

Try again.  The discovery of nylon digesting bacteria that have developed new enzymes that help them to metabolize nylon waste byproducts is a clear example of favorable mutations occurring and of increased genetic information.  

In the 70s, some Japanese scientists observed what looked like a lawn of bacteria on nylon-polymer waste, which is synthetic, and normally inhospitable for bacteria.  After some studies in the lab, they found the bacteria had evolved an entirely new enzyme now called nylonase entirely for the breakdown of nylon in less than the 35 years since nylon was first produced.

Keep in mind, enzymes are COMPLEX structures of many proteins


These enzymes did not exist prior to 1935 - the year nylon was introduced.  This is a clear example of evolution and natural selection.
 


Posts: 1460 | Posted: 10:34 PM on January 17, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Hi Orion
Try again.  The discovery of nylon digesting bacteria that have developed new enzymes that help them to metabolize nylon waste byproducts is a clear example of favorable mutations occurring and of increased genetic information.


Aah but is it mutation and selection that has caused this to happen?
I'm not a chemist but aren't even synthetic products made up of atoms that already exist on the earth as well as standard bonds that exist on this earth? In that sense nylon is a made up mix of previously available parts so maybe so-called 'nylonase' is not such a big thing after all?

Japanese researchers demonstrated that nylon degrading ability can be obtained de novo in laboratory cultures of Pseudomonas aeruginosa [strain] POA, which initially had no enzymes capable of degrading nylon oligomers. This was achieved in a mere nine days -suggesting that 35 years of nylon is somewhat irrelevant to the problem. The rapidity of this adaptation suggests a special mechanism for such adaptation, not something as haphazard as random mutations and selection.
It seems clear that plasmids are designed features of bacteria that enable adaptation to new food sources or the degradation of toxins. The details of just how they do this remains to be elucidated. The results so far clearly suggest that these adaptations did not come about by chance mutations, but by some designed mechanism.

This is a clear example of evolution and natural selection.


Not.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 07:12 AM on January 18, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester -

Regarding nylon degradation ability in bacteria, here is the original article on the experimental study you mention.  It is by the actual researchers, not a quote  from 'AnswersInGenesis' website.

Nylon Degradation in the Lab

It's a technical paper, and I didn't follow it all.  But read the concluding paragraph at the end of the article:

In the present study, it was shown that microorganisms can
acquire an entirely new ability to metabolize xenobiotic compounds
such as a by-product of nylon manufacture through the
process of adaptation. The artificial expansion of the metabolic
diversity of microorganisms toward various unnatural compounds
would be important in terms of biodegradation of
environmental pollutants


Mind you, they are talking about adaptation to metabolize nylon byproducts thru the mutation of genetic material.

If that isn't evolution through the process of  natural selection, then explain to me what it is?
 The researchers in the article don't seem to have a problem associating it with evolution.  See the title of the paper:

Emergence of Nylon Oligomer Degradation Enzymes in
Pseudomonas aeruginosa PAO through Experimental Evolution
 

In fact, I would say that this is a nice example showing experimental proof that evolution can, and does, occur thru genetic mutation.

 


Posts: 1460 | Posted: 1:16 PM on January 18, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Orion says
Mind you, they are talking about adaptation to metabolize nylon byproducts thru the mutation of genetic material.

If that isn't evolution through the process of  natural selection, then explain to me what it is?
The researchers in the article don't seem to have a problem associating it with evolution.  See the title of the paper:


Adaptation is not evolution. Evolution is the introduction of a new species. It seems to me that the Japanese researchers "created" a bacteria that behaves differently. The mention of "experimental evolution" is an oxymoron unless the evolution referred to is micro-evolution which is not in question.

Again, lets make sure we are talking about the same subject. Evolitionists believe that life originated from non-life than mutated into the multiplicity we see today.

Adaptation from a short beaked finch to a long beaked finch still results in a finch. Which is still a bird.

You can't lump micro and macro into the same argument (unless you are making fast cheesy noodles) just so you can claim that evolution is a provable fact.




 


Posts: 226 | Posted: 6:28 PM on January 18, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Timbrx - I disagree.  The bacteria DNA underwent a mutation that allowed it to produce new enzymes that enabled it to use nylon as an energy source, a source of food.  That a different bacteria was shown in the laboratory to adapt, via genetic mutation, to using nylon byproducts as a food source gives empirical evidence of the processes that evolutionary theory posits.  It's an example of the proof you were asking for.  And presented with that proof you try to weasel out of it by saying it is a mere adaptation by the bacteria.

An adaptation is a feature that is common in a population because it provides some improved function. Adaptations are well fitted to their function and are produced by natural selection.

url=http://understandingevolution.com/evosite/evo101/IIIE5Adaptation.shtml" rel="nofollow]From Here - Evolution 101[/url]

So - adaptations are produced by Natural Selection!  That certainly sounds like evolution to me, and as Darwin explained it.  And as we see in our example of the nylon degrading bacteria.

As for the evolution of a new species, you have yet to present an alternative explanation to evolution of what we see in the fossil record.  

The Flood as depicted in the Bible is not a credible explanation.  There is no geological evidence supporting a worldwide flood as described in Genesis.
 


Posts: 1460 | Posted: 12:14 AM on January 19, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Orion, I did not ask for proof of adaptation within a species. I asked for proof of mutation to a new species. If you read the article you will note that the bacteria in question is called Psuedomonas aeruginosa at the beginning of the article as well as at the end. Yes, a change in the enzymatic process but not a change in the phylotype . Very interesting but not germaine.
 


Posts: 226 | Posted: 10:22 AM on January 19, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Timbrx - the point is that it is a specific example showing that mutation of genetic mateial do occur as described by evolutionary theory.

A more striking experiment is the long-term e-coli experiment in which 12 seperate populations of e-coli that were derived from a single e-coli bacterium were observed over a period of 20 years.

But sometime around the 31,500th generation, something dramatic happened in just one of the populations - the bacteria suddenly acquired the ability to metabolise citrate, a second nutrient in their culture medium that E. coli normally cannot use.

Indeed, the inability to use citrate is one of the traits by which bacteriologists distinguish E. coli from other species. The citrate-using mutants increased in population size and diversity


Long term ecoli experiment

And still you ignore to provide an answer explaining the fossil record that does not involve evolution.  A credible answer.  Not a mythological one.
 


Posts: 1460 | Posted: 11:18 AM on January 19, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Sorry, Orion. I answered the fossil record question on the "why do you believe" thread. If you want, I can paste it over here.

Nobody is denying that mutation of genetic material occures both in nature and in the lab. And while it is described in evolution theory, it is also alluded do in the bible. With sin entered death and decay. Without death there is no mechanism for mutation.

I find it facinating that bacteria such as E-coli are designed to addapt to change in their environment. They don't even have to think about it. God doesn't miss a trick.
 


Posts: 226 | Posted: 6:36 PM on January 19, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

timbrx - Yes, I agree - Nature is wonderful.  That's what makes science interesting.  
 


Posts: 1460 | Posted: 3:03 PM on January 20, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Yes, science is very interesting. My field involves preservation of native biodoversity in southern longleaf and wetland ecosystems through the use of prescribed fire. It is absolutely amazing how some species have adapted to fire in their environment. Even animals like it. But I have seen no evidence in the field to make me believe that adaptations lead to a new species. I have many collegues who disagree. But we all agree that humans have an innate need to improve their environment whether interior or exterior. That to me is consistant with a creator God who intended man to tend the "garden".
 


Posts: 226 | Posted: 4:43 PM on January 20, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Quote from timbrx at 4:43 PM on January 20, 2009 :
Yes, science is very interesting. My field involves preservation of native biodoversity in southern longleaf and wetland ecosystems through the use of prescribed fire. It is absolutely amazing how some species have adapted to fire in their environment. Even animals like it. But I have seen no evidence in the field to make me believe that adaptations lead to a new species. I have many collegues who disagree. But we all agree that humans have an innate need to improve their environment whether interior or exterior. That to me is consistant with a creator God who intended man to tend the "garden".



No biologist would ever tell you adaptations lead to new species. Adaptation is a change that occurs to an organism during its own lifetime. Evolution, on the other hand, is the change of an entire population, a process that is made possible by random mutation and natural selection. Evolution, we know, does lead to new species, or we wouldn't be able to observe it happening.


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 11:35 PM on January 20, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

No biologist would ever tell you adaptations lead to new species. Adaptation is a change that occurs to an organism during its own lifetime. Evolution, on the other hand, is the change of an entire population, a process that is made possible by random mutation and natural selection. Evolution, we know, does lead to new species, or we wouldn't be able to observe it happening.


I don't know about that. I think the guys quoted in this article are bioligists:
ecause of their rapid rate of replication, ease of laboratory analysis, and the wide diversity
of laboratory-generated mutants that can be obtained, bacteria have been described as an
excellent model for studying the processes of evolution (Mortlock, 1984).  Acquiring resistance to a specific antibiotic provides a clear benefit to the bacterium when exposed to that antibiotic.  Thus, the acquisition of antibiotic resistance is commonly cited as an example of “evolutionary change,” and has become a popular example of so-called “evolution in a Petri dish.”  Miller (1999) refers to the development of antibiotic resistance as an example of evolution’s “creative force.”  Barlow and Hall (2002) refer to it as “the unique opportunity to observe evolutionary processes over the course of a few decades instead of the several millennia that are generally required for these processes to occur.” (p. 314)

Evolution is often described simply as ‘change’ or ‘change in gene frequency over time’ (Dillon, 1978; Johnson, 2000; Patterson, 1978), and evolutionists have almost universally maintained that any change in genotype (or even phenotype) is an “evolutionary change.”  As such, any biological change of an organism, including antibiotic resistance, would fit within this definition.  However, mere biological change also fits within a creation model, and thus this “vanilla” definition does not readily distinguish itself from creation.  This definition also does not specify the type of change (such as deleterious versus beneficial), thus it fails to offer any predictive value to the theory.

What is more, any change that appears to provide a so-called “beneficial” adaptation is commonly seen as a driving force of evolution.  Indeed, some mutations, such as antibiotic resistance, can be beneficial since they may provide the organism an increased ability to survive under very specific environmental conditions.  Thus, evolutionists typically conclude that genetic examples of “evolutionary change” are abundant and that creationists are forced to deny this readily observed evidence.

 


Posts: 226 | Posted: 12:59 PM on January 21, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

No biologist would ever tell you adaptations lead to new species. Adaptation is a change that occurs to an organism during its own lifetime. Evolution, on the other hand, is the change of an entire population, a process that is made possible by random mutation and natural selection. Evolution, we know, does lead to new species, or we wouldn't be able to observe it happening.


I don't know about that. I think the guys quoted in this article are bioligists:


I'm sorry. Perhaps I should amend the choice of words from "no biologist" to "no intellectually honest biologist." You're quoting an article from the Creation Research Society, timbrx. For an attempt at giving us a definition of evolution that biologists actually use, that's not very effective.

Here's the other, perhaps larger, problem with the article you cite: It doesn't necessarily disagree with me when it comes to the definition of evolution, the subject of our discussion at the moment.

Because of their rapid rate of replication, ease of laboratory analysis, and the wide diversity
of laboratory-generated mutants that can be obtained, bacteria have been described as an
excellent model for studying the processes of evolution (Mortlock, 1984).  Acquiring resistance to a specific antibiotic provides a clear benefit to the bacterium when exposed to that antibiotic.  Thus, the acquisition of antibiotic resistance is commonly cited as an example of “evolutionary change,” and has become a popular example of so-called “evolution in a Petri dish.”  Miller (1999) refers to the development of antibiotic resistance as an example of evolution’s “creative force.”  Barlow and Hall (2002) refer to it as “the unique opportunity to observe evolutionary processes over the course of a few decades instead of the several millennia that are generally required for these processes to occur.” (p. 314)


None of this has anything to do with adaptation. So far, the author has offered definitions that agree evolution is the change in the genetics of a population and not a single organism during its own lifetime, which is adaptation.

Evolution is often described simply as ‘change’ or ‘change in gene frequency over time’ (Dillon, 1978; Johnson, 2000; Patterson, 1978), and evolutionists have almost universally maintained that any change in genotype (or even phenotype) is an “evolutionary change.”  As such, any biological change of an organism, including antibiotic resistance, would fit within this definition.


It's unclear exactly what the author means here. If he means to say that biological changes that occur to an organism during its own lifetime are considered evolution, then he is wrong by virtue of the very definitions he's using to support his opinion. If he simply means any biological change occurring over multiple generations, then he would be correct.

However, mere biological change also fits within a creation model, and thus this “vanilla” definition does not readily distinguish itself from creation.  This definition also does not specify the type of change (such as deleterious versus beneficial), thus it fails to offer any predictive value to the theory.


Again, it's unclear if he's trying to confuse adaptation with evolution, or if he's using the actual definition the scientific community accepts. All we know for sure is that he's arguing observed evolution of bacterium populations is not disproof of creation, but that doesn't have anything to do with whether or not evolution can occur during an organism's lifetime; it isn't what he's talking about here.

What is more, any change that appears to provide a so-called “beneficial” adaptation is commonly seen as a driving force of evolution.  Indeed, some mutations, such as antibiotic resistance, can be beneficial since they may provide the organism an increased ability to survive under very specific environmental conditions.  Thus, evolutionists typically conclude that genetic examples of “evolutionary change” are abundant and that creationists are forced to deny this readily observed evidence.


He seems to be saying that observed instances of evolution through beneficial mutations within a population of bacteria do not negate creation. In other words, he's making the argument that microevolution is acceptable under a creation hypothesis and that it doesn't affect the debate. Whether he's justified in that opinion or not isn't the question. The question, which he does not address, is whether adaptation can occur over more than one generation (it can't -- that's evolution).



(Edited by EntwickelnCollin 1/21/2009 at 10:11 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 10:03 PM on January 21, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Ecoli,

Perhaps I should amend the choice of words from "no biologist" to "no intellectually honest biologist."

I have to agree with you here. The biologists referred to in the article, Mortlock, Miller,Barlow & Hall, etc. are all evolutionists.

Because of their rapid rate of replication, ease of laboratory analysis, and the wide diversity
of laboratory-generated mutants that can be obtained, bacteria have been described as an
excellent model for studying the processes of evolution (Mortlock, 1984).  Acquiring resistance to a specific antibiotic provides a clear benefit to the bacterium when exposed to that antibiotic. Thus, the acquisition of antibiotic resistance is commonly cited as an example of “evolutionary change,” and has become a popular example of so-called “evolution in a Petri dish.”  Miller (1999) refers to the development of antibiotic resistance as an example of evolution’s “creative force.”  Barlow and Hall (2002) refer to it as “the unique opportunity to observe evolutionary processes over the course of a few decades instead of the several millennia that are generally required for these processes to occur.” (p. 314)


You said "No biologist would ever tell you adaptations lead to new species. Adaptation is a change that occurs to an organism during its own lifetime."
Than you say that the above quote " It doesn't necessarily disagree with me when it comes to the definition of evolution, the subject of our discussion at the moment."

"The acquisition of resistance..." is adaptation.
"sited as an example of evolutionary change..." means evolution. As in adaptation leads to evolution.

Can you please explain how adaptation leading to evolution "doesn't necessarily disagree" with "No biologist would ever tell you that adaptations lead to a new species".

When you contradict yourself in your first three sentences, that's not very effective.



 


Posts: 226 | Posted: 5:10 PM on January 23, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Acquiring resistance to a specific antibiotic provides a clear benefit to the bacterium when exposed to that antibiotic. Thus, the acquisition of antibiotic resistance is commonly cited as an example of “evolutionary change,” and has become a popular example of so-called “evolution in a Petri dish.”  


Sadly for the evolutionist, these examples of adaptive change invariably occur due to a loss of information (eg. loss of binding sites due to protein mutation) so it is not the sort of onward upward evolutionary change  that we need to prove the existance of in order to decide whether increasing complexity could possibly occur as a result of mutation and natural selection.

Despite generations of zapping and manipulation, they remain bacteria and often less functional ones at that.  


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 01:27 AM on January 26, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Lester, please fix the quote HTML in your post. Thanks.



Timbrx, you still seem to be confused as to what the article you're citing is actually saying. This is the quote you're using as evidence that adaptation can cause evolution:

Because of their rapid rate of replication, ease of laboratory analysis, and the wide diversity
of laboratory-generated mutants that can be obtained, bacteria have been described as an
excellent model for studying the processes of evolution (Mortlock, 1984).  Acquiring resistance to a specific antibiotic provides a clear benefit to the bacterium when exposed to that antibiotic. Thus, the acquisition of antibiotic resistance is commonly cited as an example of “evolutionary change,” and has become a popular example of so-called “evolution in a Petri dish.”  Miller (1999) refers to the development of antibiotic resistance as an example of evolution’s “creative force.”  Barlow and Hall (2002) refer to it as “the unique opportunity to observe evolutionary processes over the course of a few decades instead of the several millennia that are generally required for these processes to occur.” (p. 314)


Note the very first sentence, timbrx: "Because of their rapid rate of replication..."

Replication is the process of copying DNA during reproduction. In other words, we're talking about more than one generation -- more than one organism. That is evolution, not adaptation.

Moreover, the part you placed in bold does not support your position. Bacteria do not acquire resistance to antibiotics during their own lifetime. That resistance is an evolved trait, not something the bacteria adapt to during their own life time. We know this is an evolved trait and not an adapted trait because we can record the DNA of the first population of the bacteria, 99.9% of which will be killed by the antibiotic, and compare that DNA with the DNA of the bacteria of the last population, 99.9% of which will survive the antibiotic. The DNA is different. What we are looking at is evolution in action. Adaptation has nothing to do with it.

The fact that evolved resistance is so observable is exactly what the author is talking about, in fact. He's admitting that evolution does occur within populations of bacteria.

You said "No biologist would ever tell you adaptations lead to new species. Adaptation is a change that occurs to an organism during its own lifetime."

Than you say that the above quote " It doesn't necessarily disagree with me when it comes to the definition of evolution, the subject of our discussion at the moment."


I said just that, timbrx, and that's because I'm right in this case: The article you cited does not disagree on the definition of evolution as the change of a population of organisms over multiple generations. In fact, that's the exact definition that the article uses.

"The acquisition of resistance..." is adaptation.


No, not true.

"sited as an example of evolutionary change..." means evolution. As in adaptation leads to evolution.


No. I just explained, and I think you get it now. The problem with this line of thinking is that it assumes developing resistance to antibiotics is something that bacteria accomplish during their own lifetimes, which isn't the case. Bacteria are fragile and relatively simple organisms, timbrx. They don't have an immune system or any kind of defense mechanism in place that would even allow them to develop resistance to an antibiotic in their lifetime. The only thing keeping the population of bacteria alive in the face of heavy antibiotic treatment is their ability to evolve around it, which takes thousands of generations of lost bacteria.

When you contradict yourself in your first three sentences, that's not very effective.


Now that I've cleared up the misconception, I don't think you'll see a contradiction anymore.



(Edited by EntwickelnCollin 1/26/2009 at 4:06 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 4:05 PM on January 26, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Sadly for the evolutionist, these examples of adaptive change invariably occur due to a loss of information (eg. loss of binding sites due to protein mutation) so it is not the sort of onward upward evolutionary change  that we need to prove the existance of in order to decide whether increasing complexity could possibly occur as a result of mutation and natural selection.


Three problems with that statement:

1.) The first part isn't always true, and I note without surprise that you have neglected to provide any evidence to back it up. In fact, resistance to antibiotics occurs when the protein binding site is changed, not lost.

2.) As I've already explained, "information" is irrelevant. What matters is whether the genome allows the organism to survive long enough to reproduce. That is all. Furthermore, I've already demonstrated that genetic mutations routinely "add information" to the genome. You have not addressed those posts yet.

3.) Did you sleep through 10th grade biology? Evolution is not an "upward" process. Life either survives the pressures of the environment, or it does not. Specific genetic mutations, such as resistance to chemicals (ex. antibiotics) allow life to survive and reproduce. This is the exact same evolutionary force that drove hominids to develop bigger brains, dinosaurs to develop feathers, and fish to develop legs and lungs. Complexity has nothing whatsoever to do with the process. If a genetic mutation that makes an organism's genome more complex helps it survive, that mutation will be selected for within the population. If a mutation that makes the genome simpler is effective instead, then that mutation will be selected for. It's all about survival, and that's it.

Despite generations of zapping and manipulation, they remain bacteria and often less functional ones at that.  


More misconceptions...

1.) Let's agree: A few thousand scientists with a measly 30 years of researching have been unable to recreate the 2.5-billion-year process of evolving bacteria into an entirely different kingdom of life. Where we disagree: You seem to think the previous statement presents a problem.

2.) If it's your claim that bacteria have been rendered less functional, provide the case studies that back your claim up.

3.) Whether or not bacteria have become less functional through labratory-controlled experiments to make them resistant to antibiotics isn't an issue that concerns the validity of evolutionary theory. It is unsurprising that bacteria whose sole environmental pressure is antibiotics would stop developing functions that help them survive outside the antibiotic-filled environment. A lack of natural pressure is obviously insufficient to cause natural selection of any genetic traits.


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 4:27 PM on January 26, 2009 | IP
timbrx

|      |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Ecoli,
Timbrx, you still seem to be confused as to what the article you're citing is actually saying. This is the quote you're using as evidence that adaptation can cause evolution:

No, this is a quote I am using to show that evolutionary biologists believe that adaptations lead to new species ie. evolution.

Adaptations are changes within a species that help it survive changes in its environment. The resistant bacteria are still the same kind of bacteria no matter how many generations are produced. This is not a higher order of bacteria as the term evolution implies.

Also, Lester10 is right.
Sadly for the evolutionist, these examples of adaptive change invariably occur due to a loss of information (eg. loss of binding sites due to protein mutation) so it is not the sort of onward upward evolutionary change  that we need to prove the existance of in order to decide whether increasing complexity could possibly occur as a result of mutation and natural selection.
The bacteria are less functional due to loss of information, not change.

Mutation Phenotypes leading to Resistances of Specific Antibiotics
Antibiotic  /                  Phenotype Providing Resistance
Actinonin -                     Loss of enzyme activity
Ampicillin -                    SOS response halting cell division
Azithromycin -               Loss of regulatory protein
Chloramphenicol -         Reduced formation of porin or a regulatory protein
Ciproflaxacin -               Loss of porin or loss of regulatory protein
Etc. etc.

 


Posts: 226 | Posted: 5:10 PM on January 26, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

No, this is a quote I am using to show that evolutionary biologists believe that adaptations lead to new species ie. evolution.


I understand that. What you're saying is not true. The word "adaptation" is not even mentioned in the article you cite. Adaptations are changes an individual organism makes in order to cope with the environment. The reason adaptation can never lead to a new species is because adaptation is not replicable in offspring. You cannot pass an adapted trait on to newer generations because the genome has remained the same.

Adaptations are changes within a species that help it survive changes in its environment. The resistant bacteria are still the same kind of bacteria no matter how many generations are produced.


False. Bacteria that eat nylon are different from their parent bacteria that cannot eat nylon. Bacteria that are resistant to antibiotics are different from their parent bacteria that are not resistant. Any genetic change that has become prevalent within a population of life over time represents evolution. Labeling something a "specie" is merely a measurement of that change. In truth, there is no exact quantifiable way to determine whether something is a different specie from another form of life -- all we can do is note genetic differences, and if these genetic differences are generally enough to prevent inbreeding within the two populations, we call them different species.

You still don't seem to be getting it, so I'll try it this way:

Evolution is the genetic change of a population of life over time.

Adaptation is nowhere in that ballpark. An example of adaptation is the invention of tools. Human beings invented these devices to help them survive the pressures of natural selection. However, these tools are not inheritable in and of themselves. Their function must be re-learned for every single generation, so it would be silly indeed to say that tools have become an evolved trait of our society, or that tools could help make us a different specie some day.

That scenario is the exact opposite of what we observe in evolving cultures of bacteria. The bacteria pass on their resistance through their genome. In other words, it is not the burden of each new generation of bacteria to adapt to the antibiotic on their own. The resistance has already been developed for them via the mechanism of evolution, before they are even born.

This is not a higher order of bacteria as the term evolution implies.


Higher order? That's gibberish, timbrx. Evolution predicts that when a natural pressure (such as antibiotics) is applied to a population of organisms, that population will evolve over multiple generations through genetic mutations to produce a population that can consistently survive the natural pressure long enough to reproduce. The genetic complexity of the population will only increase if such a genetic mutation is useful in helping it survive long enough to reproduce.

The other problem with using your vertical "order" test is that it isn't measurable. You can't look at an elephant and a rhinocerous and say which one is higher on the evolutionary ladder. The only thing we can is if the population of life is able to avoid extinction, and on that note, bacteria are much more capable than we ever will be. If a population must evolve to what you might call a "lower order" of life in order to avoid extinction, or if it must stay the same for that matter, it is still evolution!

The bacteria are less functional due to loss of information, not change.


You have cited nothing to support this conclusion. A loss of an activity/ability does not mean that the actual encoding information is gone. Certainly we can conclude that the information required to code for such things is broken by various mutations, but that information is easily regained once you re-apply the appropriate pressures to the culture of the bacteria. If the loss of the activity/ability does not prohibit the bacteria from reproducing, there is no reason such an activity/ability would have to be passed on. Remember: This is an environment where the only pressure is an antibiotic; the bacteria don't need many of these other processes to survive, so they stop developing them. When such pressures are re-applied, however, bacteria are as effective as ever at evolving around the problem.





(Edited by EntwickelnCollin 1/26/2009 at 5:48 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 5:42 PM on January 26, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

What is this 'loss of information' you keep referring to?  A mutation doesn't create a loss of information in DNA - it merely changes the DNA - with either a negative, neutral, or benefical outcome to the organism.  

In fact, resistance to antibiotics occurs when the protein binding site is changed, not lost.


my degree is in chemistry, and I can tell you that Entwick is correct when he makes the statement above.  That's pretty basic biochemistry.  No mystery there.
 


Posts: 1460 | Posted: 5:56 PM on January 26, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I read the SciAm article two days ago. It is the same old tired arguments against academic freedom that colleges and universities have been using for years to intimidate and silence opposing viewpoints.
Academic freedom? "Academic" means "Associated with academia or an academy". Not a church.

timbrx
I love the pictures. Perhaps they represent a common creator ratherthan a common ancestor.
Let us make man in our image. We already made the chimp 90% in our image, so why not...

So... Those similarities that make you think about a common creator... Are they enough to call humans "apes"?

If humans are today so similar to Adam, and the apes are so similar to humans... And the diferent species of the ape "kind" have "devolved" from one original pair in the ark... Why are chimps genetically closer to humans than to gorillas? Why are gorillas genetically closer to chimps and humans than to orangutans?

Did chimps and humans accidentally devolved genetically closer together? Or chimps were always chimps, but a branch of chimps quickly devolved into the rest of the apes, while some remained chimps?

Or perhaps, since the "ape" kind doesn't consist on huge animals who were difficult to stack in the Ark, God allowed the concepts of "gibbon kind", and the "Barbary Ape kind", and the "gorilla kind", and the "orangutan kind"...

Do bonobos belong to the chimpanzee kind?

From Wiki:
Often, non-human apes are said to be the result of a curse—a Jewish folktale claims that one of the races who built the Tower of Babel became apes as punishment, while Muslim lore says that the Jews of Eilat became non-human apes as punishment for fishing on the Sabbath. Some sects of Christianity have folklore that claims that these apes are a symbol of lust and were created by Satan in response to God's creation of humans. It is uncertain whether any of these references are to any specific apes. All of these concepts date from a period when neither the distinction between apes and monkeys, nor the fact that humans are apes, was not widely understood, or understood at all.
Do you believe non human apes were created by satan?


4.Agreed. Evolution within a species is identifyable. But where is evidence of anything slowly changing into something else?
Do kangaroos belong to the kangaroo kind, or the marsupial kind?

If it's the kangaroo kind, why did God put almost every marsupial in Australia I(or sent them from Mount Ararat)? If it's the marsupial kind, how could have any animal devolved into such a fit variety of well adapted species?

Yes I feel an obligation to fight this by whatever means necessary WITHIN THE FRAMEWORK OF CHRISTIAN MORALITY. The enemies of our nation aren't so bound.
Neither do you, fortunately. If you were, you'd have to kill me. Hehe... he... hehe... :S

And don't make me quote your Bible. You should read it and know what i mean.

Evolution of a species - increased genetic information - is nonexistant. Ask Richard Dawkins to give you one example of mutation resulting in an increase of information.
I don't need the good Dawkins. Gene duplication plus mutation equals increase. It's up to you to call it "information" or not, but that's what we're all made of. I don't care to call it "information" or whatever.

An a molecular level evolution becomes a mathamatical impossibility.
Are you good at Mathamatics? Somehow i doubt it...

Even the simplest form of life could not function without all of its complex parts working together in harmony.
Huh? U sure?

When you say "Even the simplest form of life" did you mean "Only the simplest form of life"? Because i'm a form of life. And you can take my complex appendix away. I'll function.

You can take a whale's vestigial hips (oh yeah, they have vestigial hips), and it will function.

All I here from you gentlemen is "it's a fact" but I see no objective emperical evidence.
The blindest person is the one who doesn't want to see.

I have never claimed that creation is a fact. I only claim that the facts support a creator rather than whatever it is you believe in.
What we believe is crystal clear.

What you believe is not. Is there a chimp kind, or does it belong to the ape kind? What was carried into the Ark?

Was the man created after the beasts? (Genesis 1:25-26)
Or was he created before them? (Genesis 2:18-19)

Were the marks attributed to the Ice Age due to the flood? Was there real ice involved? Are they due to depositions during or after the flood?

How and when did parasites appear?

Were there any lions in the Garden of Eden? With claws, teeth, short digestive tract and everything?

Could the "real world" consist of more than what is currently known? What do you know about other dimensions?
That would be beyond our use of the word "world".

Scientists admit to 10 to 34 such dimensions. Could God exist in one of them? If so, could He possibly transcend more than one?
Since when do you admit to what the scientists say?

Anyway, our use of the word "world" is quite limited. And our use of the word "exist" simply means to interact with the "world".

You could say that everything we see is a part of God. But being God infinite by definition, He couldn't fit in a finite world such as ours. And thus He does not "exist".

Relagating something you know very little about to myth is denying the possibility of anything beyond what you personally know.
That's another myth. xD

I think you are probably quite intelligent. Maybe you even know half of everything. Could God exist in the other half?
No.

Please submitt some actual evidence. I have seen only conjecture so far.
We have a plantaris muscle. That's for swinging from branches using our feet.

If God decided to recycle the ape model, why didn't he throw the unnecessary garbage away? Like our plantaris muscle, the appendix, the long canine teeth root... (Let alone the now turned off genetic instructions for a tail and a thick fur.)

Where is one irrefutable fact that evolution is more than conjecture?
Whales and snakes have vestigial hips.

1. "this does not address...
Actually, it does. Science is not absolute. It is constantly "evolving" and " knowledge can be observed and tested" in the classroom, the laboratory or anywhere else that thinking people strive to better understand the world.
Indeed! But if we were to doubt over and over again the same facts, and should put to the test again and again the same myths that some left behind people still believe, we would never make any progress.

Do you really think if I said "no, 1+1=3" that I would necessarily believe that now 1+1=2 is no longer true? I'm not insane, I assure you. (At least I don't think I am. ;)
I hope that having an imaginary friend is a phase. ;)

Anyway, you're pretty much saying that when you disregard gene duplication + mutation as an example of increase.

Lester10
I think what you're not quite getting here is that we truelly believe that the scientific evidence supports an intelligent designer called God. There are only two possibilities -we were created  or everything created itself.
I don't understand your use of the word "created".

What about Mathematics, snowflakes and the color blue? Where they created? Did they create themselves?

But I think ultimately, fear not, Christianity is not going to be forced like evolution is currently.
Would you like to establish your own creationist country? With creationist laws... And creationist scientists, making creationist computers (with creationist quoting code)! And creationist vaccines! That would be cool!

Our evolutionist vaccines don't seem to work for long. Perhaps they don't have enough faith and prayer.

However, the evidence for both viewpoints should be held up to the light to see which one makes more sense.
Not even your use of the word "both" makes sense. There are a LOT of "viewpoints" about the way life begun and came to be what it is today. Not two.
We just teach the only one that makes sense and is supported by the evidence.

We reject evolution as God and have good reason for doing so. The moral implications of evolution being preached as truth are already everywhere -time to fix it.
Science deals with evidence. Not with morality.

About the nylon digesting bacteria you said:
Lester10
It seems clear that plasmids are designed features of bacteria that enable adaptation to new food sources or the degradation of toxins. The details of just how they do this remains to be elucidated. The results so far clearly suggest that these adaptations did not come about by chance mutations, but by some designed mechanism.
Could you call that designed mechanism "Evolution"? Is it the name that bugs you?

Couldn't God design a mechanism that allowed life to appear and evolve?

timbrx
Adaptation is not evolution. Evolution is the introduction of a new species.
Not!

Evolution is the change of the frequencies of alleles through time.

The introduction of a new species is what bugs YOU. Not necessarily what Evolution is all about.

It seems to me that the Japanese researchers "created" a bacteria that behaves differently.
It seemed different to Lester10. To him it seemed like there was some divine mechanism that allowed a bacteria to behave differently. Or something like that.

The mention of "experimental evolution" is an oxymoron unless the evolution referred to is micro-evolution which is not in question.
Then call it all "micro-evolution".

Are you sure it's not in question? I've heard from creationists that only "devolution" was possible...

Again, lets make sure we are talking about the same subject. Evolitionists believe that life originated from non-life than mutated into the multiplicity we see today.
Nah. Some believe we were planted here by aliens. And it doesn't matter to Evolution.

Orion
But sometime around the 31,500th generation, something dramatic happened in just one of the populations - the bacteria suddenly acquired the ability to metabolise citrate, a second nutrient in their culture medium that E. coli normally cannot use.
Woah! Cool!!!

timbrx
I find it facinating that bacteria such as E-coli are designed to addapt to change in their environment. They don't even have to think about it. God doesn't miss a trick.
Yeah, by the 31,500th generation, on just 1/12 populations, controled by humans who can throw the vial away. Quite a trick.

You said before that it seemed to you that humans (japanese, more precisely) had created the nylon digesting bacteria. But when it's citrate, it must be God, right?

Nevermind that. What if God designed a mechanism that allows this bacteria to form colonies 31,500² generations later? And allows them to specialize, and form multicellular organisms later on? And allows them to have hopes, fears and religions later on?

What if it's not the first time?

Edit: Creation guys, please, check your quoting code before posting. There's a "preview" option.


(Edited by wisp 2/2/2009 at 11:59 PM).


-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 11:50 PM on February 2, 2009 | IP
    
[ Single page for this topic ]

Topic Jump
« Back | Next »
[ Single page for this topic ]
Forum moderated by: admin
    

Topic options: Lock topic | Unlock topic | Make Topic Sticky | Remove Sticky | Delete thread | Move thread | Merge thread

 

© YouDebate.com
Powered by: ScareCrow version 2.12
© 2001 Jonathan Bravata. All rights reserved.