PRO

Where Your Ideas can change Minds

Please visit our new forum at

http://www.4forums.com

CON


YouDebate.com Forum
» back to YouDebate.com
Register | Profile | Log In | Lost Password | Active Users | Help | Board Rules | Search | FAQ |
Custom Search
» You are not logged in.   log in | register

  YouDebate.com Forum
   Creationism vs Evolution Debates
     Information
       What do creationists mean by it?

Topic Jump
« Back | Next »
Multiple pages for this topic [ 1 2 3 4 5 ]
Forum moderated by: admin
    

    
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Well Wisp -that took me along time to plough through and to do it justice I'd have to be sitting here for a long time so excuse me if I only answer parts.
Thanks for trying. I know i write a lot.

If there's information ANYWHERE, there's information EVERYWHERE. And everything is information.
Well I suppose that's true in a sense.
It's really true to me. And, in a sense, all information is divine, so everything is God. But i'm sure you won't like my way of being a believer...
But I think that natural law keeps things going the way they are designed to go and information is used where there is specific purpose.
I seriously can't figure out what you mean by "information". I honestly believe that you don't know, but you think you know.

If you do know answer this: Do animals need information to produce venom?

I can answer "yes" or "no" and proceed to justify my answer (which will be about semantics, probably).

But i believe that you can't.

The emerald wasp produces two kinds of venom: one that paralyzes the victim's limbs temporarily (this one gets injected in the convergence of the limbs), and one that inhibits the flight reflex (injected into the brain).

I don't mind to call it information. But you do. With no valid reason. Only that Yahweh wouldn't produce information so ugly. And that the Bible says animals lived in harmony.

But you stay away from facts. And not even the concepts help you in this case.

It's not me who limits it. It's that it's not really a possibility. It's a glitch in our brains.
Who says its not really a possibility -you? How can you demonstrate that it's a glitch in our brains?
Because it doesn't mean anything.

Picture this concept:
Imagine a car so fast and with such a good grip that can go around the block and arrive before departing.

There's nothing that would look or behave like that supposed car. If you seriously consider it a "possibility", there's your glitch.

This example was clear (i hope). The "supernatural" glitch is more complex than that. But still doesn't refer to anything conceivable.

You think that you're conceiving something, but you're not (in my opinion).

Like most glitches (if not all of them) it produces paradoxes. I can come up with some paradoxes if you're interested (i'd have to give it some thought).

You're the one that says that you back everything up -but you don't you know, you just believe yourself and think that that is good enough.
Actually you're kinda right. I do tend to believe myself. I have built some degree of self-confidence that tells me that i'm probably right.

But that confidence is supported by facts, if it makes any difference.

I backed my claim up not by a demonstration but by a comparison with another glitch (easier to understand).

Would paradoxes be enough demonstration of the glitchy nature of the concept of "supernatural"? What would be enough for you?

Can a chair make itself?
Sure.
What are you talking about -explain -my computer could take ten years to download this so I'm not even going to try.
I forgot your slow connection. I apologize. It was about a robot chair that builds itself up when torn apart. It was meant as a joke.

No. A chair doesn't make itself. But we're talking about Evolution here, so this is not relevant.

Can matter make itself?
Not that we know of, no.
Why do you ask?
So where does matter come from. My Bible says that an intelligent eternal being created matter, space and time. Where does matter come from in your opinion?
After having studied (a little) and meditated (a lot) on theoretical physics i concluded that matter is information, in a complex system that is self-explanatory (even if we don't find the complete explanation in my whole life).

Ok, information is divine.
Ok, information comes from God.
Ok, God is behind everything.

Can we switch back to Evolution now?

So where did the natural laws come from? We say that God programmed the natural laws that operate - pretty intelligent hey? So where did you say the natural laws came from??
They are properties of this self-explanatory universe.

They don't "come", so from nowhere.

But if you want me to say "From God", ok. That must be true in some way, because ultimately everything comes from God.

Can we switch back to Evolution now, please?

Take an ice cube from your refrigerator. Watch it melt. That melting was a natural process. No intelligence was needed.
No but natural law was needed.
Indeed.

Yawn...

Ok. But i don't feel. I reason. And i can back it up.
A little bit of shallow rhetoric there. If you backed things up with evidence that makes sense and is not just assumed because of your ability to 'reason', perhaps that would help.
I'm not sure about what you're asking from me.

You can always reply:
"That's not evidence. That's a link", or "That's not evidence. That's just reasoning.", or "That's not evidence. That's just a picture."

Are you just trying to take every single one of our accusations against ourselves? Hahaha!

It's not us who refuse to discuss facts.

By the way, where did your ability to reason come from
Reasoning, intelligence, consciousness, they are all divine in nature.

But if you ask where did they come from, you're talking about something historical. The answer to that one would be "From nature" then.

-random chemical attractions between atoms which happened to evolve into billions of neurons which happened to connect wihtout any plan or purpose?
Hahahahahaha!

Whenever you add "random", the answer will most likely be "no". xD

No part of science denies my beliefs.
No because you're always looking to back up your beliefs and fortify them.
If i was wrong i would have many problems trying to do that.

Much like you do when trying to figure out claws and venom carrying hollow fangs.

In my case most things go so very smoothly...

That kind of harmony should mean that i'm right, or that there's some powerful uncanny force trying to deceive me. A weird force that tends to affect the smart people first...

Evolution can explain everything.

Your biblical hypothesis can't even explain venom.

Like looking for plausible evolutionary paths for things that exist and plausible evolutionary reasons for why things do what they do. You are reinforcing your belief system constantly.
It gets constantly reinforced by reality.

Why can't you do the same?

Creationists advocate on behalf of creationism. They (try to) develop  strategies. They defend each other. They are very careful about contradicting each other. They promptly accept what other creationists say.
Where did you suck this from or do you just believe it?
I see it.

Timbrx and you disagreed on some important issues. Like vestigiality!
That was an accident. You don't like disagreeing.

You said that you have no problem admitting vestigials, because devolution causes them.

Timbrx basically said that what appears to be vestigials must have some function (however obscure).

Would you say that he's wrong?

Have you not seen me correcting and discussing with other evolutionists?

I know lots of creationists that don't accept everything that ID says.
Yeah, like EVERYONE!

ID implies that some intelligence designed venoms, fangs, claws, etc.

Behe thinks that malaria was intentionally designed. I could be wrong, but i bet you don't.

To be a creationist does not mean that your brain is switched off and if we don't use your blatent rudeness to drag each other down, it is not necessarily because we agree with everything the others say -that is just your incorrect assumption.
Then answer this one. Do you believe that you made a mistake, or Timbrx did, or both did. No other options here.

I accuse you of playing deaf with many of my questions, and not because they were too many, but because you didn't know what to say. That's dishonesty.

Perhaps we encourage one another -we are a minority group after all. But then I see you with Derwood (especially) and some of the others and there is so much back patting
I'll pat your back too whenever you surprise me with something of worth. Have i never done so?

I think in one occasion even gluteus said something that showed some understanding.
going on for nothing particularly intelligent that I can only sit and wonder.
Like what?

It seems more likely that you didn't fully understand it than that i patted a back in vain.

If they can disprove something, they will. They are eager to disprove each other
Maybe with repeatable observable science but not with evolution -
Man, you've demonstrated that the only "science" you respect is the one that (you think that) doesn't contradict your holy book.

All science is observable, or none is.

unless you get an ego clash like with some of the hominid paleontologists where they contradict the other's imaginary stories all the time just because they hate each other's arrogance.
Hahahahaha! You can't even mention this!!

If scientists disagree about some tagging it's not big. They're solving a puzzle.

If creationists do, it's HUGE! Because you claim that there's no such puzzle! That everything is clear! That a fossil is either human or not!

And yet we get this creationist classification of hominid fossils:


Are you not ashamed? Not one bit?

It can get quite ugly but it shows the rest of us just how imaginary their made up stories are.
If people who says it can be confusing get confused is not nearly as revealing than if people that say it's crystal clear get confused.

I hope you get this.

We disagree.
But not when there are creationists around, just in case they get the wrong idea.
This is me shutting you up:

Quote from wisp at 12:04 AM on April 8, 2009 :
With that said, when one takes into consideration some of the things people were asked to do in the name of Jesus in the bible, if someone did those exact same things today they would be found guilty of a crime or looked at as they are crazy..
What? Loving your enemy? What are you talking about?
If you were on jury duty and a guy on trial stated that he was told by God to kill his brother as in the story of cain and able,
Consider reading the story, or avoiding mentioning it.

Perhaps you have some point (i wonder what its relation with the subject of this forum might be), but it gets diluted by your mistakes.
Now that wasn't back patting, was it?

I also discuss a lot with Fencer (who is an evolutionist, in spite of his nickname).

I have had discussions with others too. Even with Derwood.

So i hope you show some honesty and take that back.

Skeptical about all except that which you accept by faith
We've shown you tons of evidence. So no, no faith.
Remember that problem that I've discussed with you about assuming naturalism in advance of the evidence?
You call facts "assumptions", and think you can just get away with it? Just by name calling?

There has been no sustainable alternative to naturalism. Ever.

No you haven't shown me evidence. You've shown me your interpretations of the evidence and then I tell you why I don't accept your interpretations.
No.
I show you pictures, you shut up.
I describe parasites, you shut up.
I name claws, venom and fangs and you shut up. I say that if the legless lizard got this way just by losing stuff it implies that devolution can imitate creation (the snake), and you shut up.

Evidence does not tell you anything. You have to interpret it.
Yes. We do. You don't.

Interpret claws, fangs, venom, etc, please. How did they get there?

When i say "tons of evidence" i mean it.

I can name thousands of things you could never explain, which are so incredibly (if you ignore Evolution) easy for us...

Creationists (even if they consider themselves successful about these) can only name a few cases of what they call "irreducible complexity".

And that would include the bombardier beetle, which seems to support ID while destroying biblical creationism (why would the bug need such a weapon in the pacific and vegan garden of Eden???).

Everything you say can be held against you.


(Edited by wisp 6/9/2009 at 10:54 PM).


-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 10:45 PM on June 9, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I was reading a list of argumental fallacies ( http://www.don-lindsay-archive.org/skeptic/arguments.html ) and found one that describe what creationists do when they talk about "information", "intent", "code", etc.

Reifying:

   an abstract thing is talked about as if it were concrete. (A possibly Bad Analogy is being made between concept and reality.) For example, "Nature abhors a vacuum."



-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 12:11 AM on June 10, 2009 | IP
Mustrum

|     |       Report Post




Member
Post Score
Adjustment:
n/a

Rate this post:

Quote from wisp at 4:22 PM on June 9, 2009 :
Actually, this is not a good process for explaining evolution.
Actually, i wasn't trying to explain Evolution.

I was trying to show how randomness can be an ingredient for something that's not random.

Why?  Because using this algorithm you are relying a predetermined answer that guides the "DNA".
Yeap. That's clear.
Evolution is not a guided process.
Depends on your definition of "guided", but yeah, i'm with you, proly.

In my application string there's a single goal, you could say. That makes it guided. Right?

But there are millions of ways to get close to it (using different polygons).

You could say the same thing about life. Only one goal: for the genes to reproduce themselves.
And millions of ways to achieve this.

Look, i know the process quite well. If this example doesn't help you to see anything more clearly, ignore it.

How can information not be physical?
How can matter be anything but information?

Let's not get lost in words.

The same datum (a lock combination) could go through many material codifications. Words, text files in CDs, handwriting, set in a lock, etc.

We would regard the datum as the same in any case. We don't do that with physical entities (except when in deep quantum meditation).



It certainly sounded like you were talking about evolution, and you were using the term DNA (albeit in an odd way) in your algorithm.

Overall, I find this discussion of information to be really confused.  I would suggest stepping back a bit and first going over some definitions.

Anyway, as written your earlier example using the Mona Lisa is essentially the ID approach to evolution.


-------
*Mustrum*
 


Posts: 143 | Posted: 10:58 AM on June 10, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 10:23 AM on May 23, 2009 :
Not so fast. Genes are material. The coding of the genes is not.


How do you know this?  Does that statement NOT presume foreknowledge of the outcome of expression?  And is that NOT an assumption that is hardly a given?

Shuffle them up and the material parts remain unchanged. The information, the intelligent ordering, the weightless non-material component is lost.


So you are assuming that an intelligentce encodes genes.  And employing this wholly unfounded, unsupported assumption as a given, you then conclude what you assume.

So I won't even mention that idiotic statement that information proceeds from an intelligent source.


Well that is actually a fact in all systems we know about.



Allow me to correct that statement - that is a fact in all of the human-contrived systems we know about.  Are you indicating that genomes were encoded by humans?  That is, in a logical sense, the ONLY thing you can be saying, for we really have no way of knowing how a non-human entity would "design" anything.
To imply that a "Designer" if life would necessarily be limited to what humans can do is the height of arrogance, it seems to me.



Oh yes, man, with a brain that operates from neuronal material and trillions of synapses that happened together by chance with no plan and no organization.


Nice strawman.


You have a lot of faith! By the way there is no direct evidence for the author of the book I'm reading but I know there is one.

Yet, one could, with the proper investigative tools, actually find the author (or his or her remains or at least information about their fate) were they to look.  Must be why IDcreationists don;'t bother looking - they know they can't find anything.
Derwood
Since genes are material, if information is non-material, then the genes are apparently irrelevant


Well that's like saying that the words you are typing are irrelevant but how else do you convey information?

There are several ways that we humans (and non-human animals and even plants) convey information that do not require the written word.


You need a material medium for your weightless wisdom.

What is the material medium for spoken 'wisdom'?  Air?  

See, the funny thing is, if genes are merely a 'medium' to carry 'information', and modifying the medium (e.g., mutations) can alter the 'information' on the medium, then the information is clearly a function of the medium.

And if the information is a function of the medium, then the medium dictrates the information.

No 'designer' needed.


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 2:22 PM on June 19, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Derwood -
See, the funny thing is, if genes are merely a 'medium' to carry 'information', and modifying the medium (e.g., mutations) can alter the 'information' on the medium, then the information is clearly a function of the medium.

And if the information is a function of the medium, then the medium dictrates the information.

No 'designer' needed.


I like the way you put that.  Thanks.
 


Posts: 1460 | Posted: 3:08 PM on June 19, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Wow. He's seriously trying to argue that objects can hold inherent nonphysical meaning in them. Genes don't have "information." It's simple chemistry: During the transcription process, when a certain combination of amino acids is present down the line, it causes a chemical reaction that builds a specific protein. That's all there is to it. Nothing inside the cell is calculating or analyzing anything. Information is nothing but an idea, a mental representation of something. It doesn't "exist" in the same sense that physical objects do.

Moreover, even if Lester was correct, this does not imply a designer. All information created by humans is indeed the result of a designer, but that doesn't necessarily extend to nature. All that means is that all things with information have been created by a designer... except for things in nature.


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 6:19 PM on June 19, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

This is what I've been trying to say, the "genetic code" isn't a code at all.  There is no symbolic meaning, no arbitrary characters that respresent something else.  It's just chemicals reacting.  We don't need a magic skyman to see how they came together, we  don't have to resort to magic to exlain how they work.  Natural processes can explain it.
Basically all people like Lester have, besides a lack of knowledge of chemistry and biology, is "Goddidit" and nothing else.
 


Posts: 1664 | Posted: 9:14 PM on June 19, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Exactly.

Imagine i take any natural piece of something, let's say a broken stone, and use it as a stamp.
-It contains information.
-What information?
-Look, i grab a piece of paper, pour some ink on it, aaaand... Presto.
-Presto what?
-There it is. It coded for this.
-What does that mean?
-I don't know, but God does.



-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 9:39 PM on June 19, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from orion at 3:08 PM on June 19, 2009 :
Derwood -
See, the funny thing is, if genes are merely a 'medium' to carry 'information', and modifying the medium (e.g., mutations) can alter the 'information' on the medium, then the information is clearly a function of the medium.

And if the information is a function of the medium, then the medium dictrates the information.

No 'designer' needed.


I like the way you put that.  Thanks.



Thanks!


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 8:47 PM on June 23, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Going back a bit and answering Wisp’s thesis – I see your looong thread Wisp and I sigh –sorry for the delay but I generally can’t get round to the long ones but then again I don’t want to ignore them either. I’ll try to answer what I can since you took all the trouble to write it!!

And, in a sense, all information is divine, so everything is God. But i'm sure you won't like my way of being a believer...


The thing is I don’t really understand it. I know that’s the way New Agers think and I was one of them myself at one stage –God is everything and everything is God and all of that. I went to the seminars, sucked it all in, meditated, used mindpower and mind workshops, did mind trips and diagnostics for medical conditions. I really loved it, spent a lot of money on it but I guess someone somewhere saw me going down the garden path and prayed for me. I was lucky, now I hear “there is no reality” and “everything is one” and I feel nothing but horror for where I might have been. I read a book that changed my mind –it’s very difficult for people to speak to you about the real God when you’re on a mission and pretty much blind but I was. I was also incredibly fortunate.

I seriously can't figure out what you mean by "information". I honestly believe that you don't know, but you think you know.


By information, I mean that the DNA is like a letter, an intelligent letter that gets transcribed onto RNA and the RNA then translates those letters into a functional protein that get folded into a specific shape that is made to perform a specific function by interrelating with other coded proteins in the correct numbers and shapes to make something purposeful occur in the body. I don’t believe that such a thing is purely a matter of chemistry nor is it according to people like Dean Kenyon who used to be a foremost authority on such chemical inter-relations. I believe that that DNA information was put there by an intelligence for a purpose and that the message is separate from the material carrier just like a DVD disc is separate from the information that it conveys. I’ve said before that DNA has to have 5 levels (statistics, semantics etc) that have to be present to constitute information. DNA has all 5 levels and thus fulfils the criteria for information.

Do animals need information to produce venom?


Yes they do. The proteins of the venom are coded for and have a specific purpose, they didn’t just fall together by chance and chemical attractions. They are for that animal’s protection. Purpose implies intelligence and a plan.

Only that Yahweh wouldn't produce information so ugly. And that the Bible says animals lived in harmony.


There its your picture of Yahweh that is idolatrous. You give him characteristics that are not his. Maybe he produced the information but it wasn’t meant for evil, only for protection. Just like we have science, we have brains, we make evil things with our brains but generally that is because we don’t listen to God, we are just fighting to survive like in the evolution worldview; we are just higher animals with no moral standard and we just do what we do for whatever reason we do it. Animals did live in harmony but after that they didn’t. That was the fall of creation, when everything went wrong after man decided to ignore God’s instructions and do it his own way. It’s like what teenagers do when their parents tell them ‘don’t’. They tell their kids things for their own protection and because they love them and the kids think they’re clever and they don’t listen. They know better.

. I have built some degree of self-confidence that tells me that i'm probably right.


That’s probably what Adam and Eve had when they decided not to listen. They went from God’s wonderful creation to God’s disobedient know-it-all better than God brats. Not to say that it’s necessarily wrong to go with your gut feeling on things –sometimes that’s right but it works much better when you have an instruction manual of right and wrong that’s in sync with your God-given conscience. That ‘s the best combo for the best results.

Would paradoxes be enough demonstration of the glitchy nature of the concept of "supernatural"? What would be enough for you?

I’m really not sure I’m following you here. Care to explain? Maybe give some examples?
No. A chair doesn't make itself. But we're talking about Evolution here, so this is not relevant.

Can anything make itself do you think?
After having studied (a little) and meditated (a lot) on theoretical physics i concluded that matter is information

I agree, only I think that information needs intelligence behind it. Thus matter obviously does too. You appear to agree that information and physical laws must come from God –but back to evolution then….
It's not us who refuse to discuss facts.

Neither do we. The problem arises when you decide that we must accept your interpretations of the facts and then imagine that our interpretations are ‘refuted’ by your interpretations.
Reasoning, intelligence, consciousness, they are all divine in nature.

But if you ask where did they come from, you're talking about something historical. The answer to that one would be "From nature" then.

Yes they are the immaterial portion of us. What does ‘from nature’ actually mean –I think that immaterial part of us is eternal and comes from God. He just gave us a body to carry the immaterial part around.
Hahahahahaha!

I love it when you laugh –especially when there are a lot of ha ha’s –that means I am being particularly dumb?! I like to brighten up your day that way.

Whenever you add "random", the answer will most likely be "no".

If it’s not random, it is purposeful, but you deny that it is purposeful so it must be random? Where am I going wrong here?
That kind of harmony should mean that i'm right, or that there's some powerful uncanny force trying to deceive me.

I would go with the powerful uncanny force that is trying to deceive you. But you don’t believe in him nor in his creator.
A weird force that tends to affect the smart people first...

A weird powerful evil force that tends to affect prideful people. Unfortunately too many clever people fall into this category. It’s like imagining that you could take God’s place because of your cleverness. You don’t need to listen to Him because you’re far too clever. My children think like that too sometimes.

Evolution can explain everything.


Perhaps it can, but is it true? Not everything has only one possible explanation.

Timbrx and you disagreed on some important issues. Like vestigiality!
That was an accident. You don't like disagreeing.


Sorry you feel that way. I don’t know where you picked up a contradiction between our views. Perhaps it is something we need to look into and clarify. The way I see it, Timbrx and I have one main thing in common and that is that we love the truth. We believe very strongly that evolution is a lie and we are distressed that people are believing the lie. That is our overriding interest in this forum.
Timbrx basically said that what appears to be vestigials must have some function (however obscure).

Would you say that he's wrong?


No I wouldn’t say he’s wrong. He may be right. I personally don’t doubt that everything had a function at some stage and was intelligently designed. However mutations may have rendered certain things vestigial in that they no longer function optimally or at all. Mostly the vestigial argument tends to be based on ignorance though. If you don’t know what it is, it must be vestigial though I think most scientists have got over that now as it becomes increasingly apparent that they were basing that supposition on a belief in the principle of evolution and that everything seems to have had a finction after all. We base our argument on the principle of creation or “God doesn’t make junk” so we assume function first –that tends to fit better with reality and helps science go forwards rather than backwards.

ID implies that some intelligence designed venoms, fangs, claws, etc.

So does creation.
Behe thinks that malaria was intentionally designed. I could be wrong, but i bet you don't.


I haven’t heard that and I don’t know what his reasoning might be. I know lots of people think that AIDS was intentionally designed but I wouldn’t know what they base their contentions on. It might be interesting to see why Behe says what he says.
I accuse you of playing deaf with many of my questions, and not because they were too many, but because you didn't know what to say. That's dishonesty.


I would think it would be honest not to say anything if you know nothing about something. I don’t know what sorts of things you are referring to though. It’s not intentional anyway. I think it is far more likely that I was short of time and answered the more important things (in my estimation) first. I often don’t answer your whole thread, I just pick things. If I answered everything, I would be here all day answering one post, like I’m attempting to do today. I think your typing must be quicker than mine or else you have lots of spare time. I wish I had more debate time. I would happily do this all day some days. I’m going out of town for three days from tomorrow so don’t think I’m ignoring you ok?! I don’t take my computer with me. I might find one where I’m going though.
I'll pat your back too whenever you surprise me with something of worth. Have i never done so?

Not that I recall but that is because I am stupid and Derwood is clever… or is it because I interpret things differently from you and Derwood……Sigh! Whatever. I know what Derwood would say –he is fuuull of ….insight!

It seems more likely that you didn't fully understand it than that i patted a back in vain.


That must be it! Usually my head reels in confusion when you pat Derwood on the back. I seldom find anything particularly stimulating in what he has to say. But I can see when you’re impressed. I do believe you’re intelligent which is why I don’t understand this thing of yours with Derwood.In fact, I find it bizarre.
All science is observable, or none is.


All science should be observable but evolution isn’t which is why it isn’t science.

Are you not ashamed? Not one bit?


No. I’d have to find out why they think what they think. Remember they’re interpreting the evidence and they have reasons for their interpretations that I’d want to hear in order to decide what I think.

Now that wasn't back patting, was it?

I also discuss a lot with Fencer (who is an evolutionist, in spite of his nickname).

I have had discussions with others too. Even with Derwood.

So i hope you show some honesty and take that back.


You always call it honesty when it means agreeing with you. In this particular case, I take that back. In others, I don’t, but in both types of cases, I am being honest. Now can I have my pat on the back?

There has been no sustainable alternative to naturalism. Ever.


But you do admit that you presuppose naturalism, don’t you. You think it is right but please admit that you do do that.

You call facts "assumptions", and think you can just get away with it? Just by name calling?


No, facts are facts and interpretations of the facts are sometimes merely assumptions based on presuppositions.

I show you pictures, you shut up.
I describe parasites, you shut up.
I name claws, venom and fangs and you shut up. I say that if the legless lizard got this way just by losing stuff it implies that devolution can imitate creation (the snake), and you shut up.


Sometimes I don’t even read your posts because I just see long and laborious and I know my time is limited and so I’m afraid, as much as I’d love to, it can be too time-consuming. I’ve enjoyed having the time to answer point for point this time but I don’t always have the luxury. My apologies for all times past where I have offended you by denying you an answer. It was not intentional. I wish you could do ‘short’ but I’m afraid that is not your way and that’s fine.

Interpret claws, fangs, venom, etc, please. How did they get there?


They were created for self-defence in a world that is not perfect? Apparently God knew in advance that his creation wouldn’t be inclined to listen to him so I suppose he programmed in everything they would need to survive in the niche they were created for.All animals have to eat after all and they at least need a fighting chance. Apparently the bigger plan made it worthwhile. How do you think those sorts of specific proteins evolved? Did the odd random mutation just happen to add up to something useful piece by piece? How did natural selection select for something that would need to be built up piece by piece, mistake by fortunate related mistake?

When i say "tons of evidence" i mean it.


All evolutionists say that but whenever they find a new ‘missing link’, it is the final definitive proof of all time, incontrovertible, unmistakable, only stupid people won’t understand why, one in a million, absolutely definitive –and we still don’t believe it. Why do you think that that is? I’ve tried to explain why but you don’t believe me. So you tell me why.
Creationists (even if they consider themselves successful about these) can only name a few cases of what they call "irreducible complexity".


No they cite particular pathways and parts by way of demonstration. They have done knock-out experiments on various pathways but obviously not all. The examples are endless but they only use particular ones by way of illustration of a concept.

Everything you say can be held against you.


Thank-you, I know that. And now my answer has come to an end. That took hours, Wisp. My typing fingers (two) are nearly completely burnt out. My brain is cooked- it takes so little with us – and now I am going to walk around and get some oxygen. It’s so cold here, I’ve been breathing in wood fumes rather than ice up. Have a nice day  









-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 08:45 AM on June 27, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Derwood
So you are assuming that an intelligentce encodes genes.  And employing this wholly unfounded, unsupported assumption as a given, you then conclude what you assume.


And you assume that no intelligence was needed to encode the genes. And employing this wholly unfounded unsupported assumption as a given, you conclude what you assume.

There, now perhaps you see what I mean by assumptions and intepretations of the same evidence in different ways.

Are you indicating that genomes were encoded by humans?  That is, in a logical sense, the ONLY thing you can be saying, for we really have no way of knowing how a non-human entity would "design" anything.


I would imagine that that is because we don't know everything.
No there is nothing logical about what you are saying and how do you know what a non-human entity could or could not design.
Are you the repository of all information?
Then you must be God! Hello!

To imply that a "Designer" if life would necessarily be limited to what humans can do is the height of arrogance, it seems to me.


Who said he is limited to what humans can do. Did I say that - no. Did you? And if so, why would you say that?

Oh yes, man, with a brain that operates from neuronal material and trillions of synapses that happened together by chance with no plan and no organization.




Nice strawman.


What strawman? Aren't you advocating that the best mistakes (mutations) selected for (natural selection) somehow put a brain together?

Yet, one could, with the proper investigative tools, actually find the author (or his or her remains or at least information about their fate) were they to look.  Must be why IDcreationists don;'t bother looking - they know they can't find anything.


We see the evidence for creation all around us then we look for the author and find him! You, on the other hand see mutation and selection all around you and imagine that that is how it happened and then you don't bother to look for your creator because you're sure he doesn't exist. Is that clever?

There are several ways that we humans (and non-human animals and even plants) convey information that do not require the written word.


Yes I'm aware of that, and God does it with DNA messaging.

What is the material medium for spoken 'wisdom'?  Air?


How do we know that it requires a medium? Maybe it is electromagnetic and can travel in a vacuum.

And if the information is a function of the medium, then the medium dictrates the information.


Doesn't logically follow, sorry. Does a DVD disc dictate what is put on it?

No 'designer' needed.


Sloppy logic. Stupid answer. Try rethink that one.

Orion
I like the way you put that.  Thanks.


Jeesh, did Derwood put a spell on you as well?
Lets just call him diabolical Derwood.

EntwickelenCollin
Genes don't have "information." It's simple chemistry: During the transcription process, when a certain combination of amino acids is present down the line, it causes a chemical reaction that builds a specific protein.


Why don't you try find out why Dean Kenyon, the writer of the book 'Chemical Predestination' who believed all that chemistry stuff enough to write the textbook that everyone had to read, doesn't believe it anymore. It would have been far easier for him to stick with it you know. In the interest of truth and reason, he repudiated it all. I wonder why he changed his mind???

That's all there is to it. Nothing inside the cell is calculating or analyzing anything.


Is there something inside your computer calculating and analyzing everything? Does it possess programmed information? Is the programmer sitting inside the computer? How do you think we happened along? Knock out the brain -what do you have? Take out the liver -any problem? Get rid of the kidneys -bit of a problem. Take away the part that codes (unintelligently) for blood vessels. What then?
How about ATP -can't live without it. Don't you see the intelligence??? Don't you see a purpose for everything in the human body???
How can it be random selection of the better mistakes? It all works together. Every protein is coded for and required. Every protein has a purpose. Every protein is coded for in the DNA.

This blindness is like madness to me.

Demon38
Natural processes can explain it.


You think they can and then you believe yourself. Welcome to the matrix.

Basically all people like Lester have, besides a lack of knowledge of chemistry and biology, is "Goddidit" and nothing else.


At least I tell you who did it -you're telling me nothing did it, it just happened, environmental pressures and all. Strange and absurd.Please demonstrate via example my lack of knowledge of chemistry and biology. I'd like to try to drag myself up to your level.

Wisp
Imagine i take any natural piece of something, let's say a broken stone, and use it as a stamp.
-It contains information.
-What information?
-Look, i grab a piece of paper, pour some ink on it, aaaand... Presto.
-Presto what?
-There it is. It coded for this.
-What does that mean?
-I don't know, but God does.


Wisp, you've had more intelligent things to say. Sorry to point it out but you've really descended to the level of the ridiculous and somewhat moronic here. I know you can do better.

















-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 09:54 AM on June 27, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 08:45 AM on June 27, 2009 :
The way I see it, Timbrx and I have one main thing in common and that is that we love the truth. We believe very strongly that evolution is a lie and we are distressed that people are believing the lie. That is our overriding interest in this forum.


And thus you believe that you KNOW the truth.  And that us poor non-YECs do not.
Isn't that awfully presumptious and pompous?

Timbrx basically said that what appears to be vestigials must have some function (however obscure).

Would you say that he's wrong?


No I wouldn’t say he’s wrong. He may be right.

And even if a vestigial does have a function, that does nto prevent it form being a vestigial.  Even Darwin explained that.  YECs should stop usinng idiosyncratic definitions when they set up their 'arguments', for doing so turns them into strawmen.

Mostly the vestigial argument tends to be based on ignorance though. If you don’t know what it is, it must be vestigial though I think most scientists have got over that now as it becomes increasingly apparent that they were basing that supposition on a belief in the principle of evolution and that everything seems to have had a finction after all.

How condescending.
And ignorant.

Vestigials need not be totally functionless.  That is a creationist invention and a belief of those who have not studied the issue in sufficient depth, including some evolutionists.

We base our argument on the principle of creation or “God doesn’t make junk” so we assume function first –that tends to fit better with reality and helps science go forwards rather than backwards.

And yet you declare even your caricature of evolution as somehow illogical... Truly amazing.
I'll pat your back too whenever you surprise me with something of worth. Have i never done so?

Not that I recall but that is because I am stupid and Derwood is clever… or is it because I interpret things differently from you and Derwood……Sigh! Whatever. I know what Derwood would say –he is fuuull of ….insight!

I'm not sure you would know what I  might write, since you folks rarely respond to my substantive points.
Usually my head reels in confusion when you pat Derwood on the back. I seldom find anything particularly stimulating in what he has to say.

Because you already know the TROOOF!  Right?  
Well, if you are not impressed with anything I write, you'd be shocked to see how stupefied I feel reading the thoughtless gibberish you regurgitate.


But I can see when you’re impressed. I do believe you’re intelligent which is why I don’t understand this thing of yours with Derwood.In fact, I find it bizarre.

I find this mutual man-crush you creationists have on each other a bit disturbing, but I don't feel the need to ramble on about it.

All science is observable, or none is.


All science should be observable but evolution isn’t which is why it isn’t science.


Can you observe what goes on inside a star?  Must be that you also feel that astrophysics is not science.  But I'll bet you think ID/creation science is science, don't you?


All evolutionists say that but whenever they find a new ‘missing link’, it is the final definitive proof of all time, incontrovertible, unmistakable, only stupid people won’t understand why, one in a million, absolutely definitive –and we still don’t believe it.

The notion of a 'missing link' is public press nonsense.

Why do you think that that is? I’ve tried to explain why but you don’t believe me. So you tell me why.


There are two primary and usually overlapping reasons:

1. A presupposition of the infallible unwavering absolute 100% truth of a collection of ancient plagiarized myths

2. an ignorance of the science involved

Let me guess - I'm a 'condescending ass', right?

Whatever.  In my 15+ years of experience in the so-called Cre v. evo debate, those are the two most common reasons I have encountered in creationist dismissal of evidence.  Add to them this weird elitist mentality that so many of you have, this notion that regardless of what you truly have skill/experience/education in, you have some sort of special insights into everything else.  The Dunning-Kruger Effect
explains it pretty well, I think.

Creationists (even if they consider themselves successful about these) can only name a few cases of what they call "irreducible complexity".


No they cite particular pathways and parts by way of demonstration. They have done knock-out experiments on various pathways but obviously not all.

Which experiments are you speaking of?
I've heard of no such experiments.  Creationists tend not to do ANY experimentation that directly tests their claims.
Behe, in fact, claimed once that it was not even up to him to test his own claims.
I have to wonder why.


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 10:19 AM on June 27, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:20 AM on May 15, 2009 :
Your site, like you, doesn't even understand evolution, it still makes the major mistake of claiming evolution is random


Or maybe you don't understand the implications of the random element of mutation?


But a random mutation would not result in the production of a brand new protein all at once by chance, unless you declare that a single nucleotide change in a gene resulting in (maybe) an amino acid substitution in the resulting protein constitutes the production of a brand new protein by random chance, in which case your claim is a purely semantic one.



Why should i waste more time in such a stupid reading?


Because it may help you.


Not likley, except perhaps to give additional insight into how the Dunning-Kruger effect runs rampant in anti-evolution circles.

Take the 'random mutation' generator that made the rounds a few years ago, hosted on a YEC site.  It was claimed that it would stop when it reached a pre-specified word, and it was claimed ot represent how evolution worked.  Except that ALL the letters changed every round, which is not at all what happens in evolution, yet the YECs who hawked this nonsense insisted it was totally like evolution.
Dunning-Kruger.


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 10:24 AM on June 27, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from wisp at 7:17 PM on May 18, 2009 :

And derwood, your statement doesn't seem to work for me. It's clear if you replace genes with DVDs.

"Since DVDs are material, if information is non-material, then the DVDs are apparently irrelevant".

Perhaps it's just a matter of semantics. Perhaps you take an extreme point of view and deem all information as material.

Actually, I was taking the creationist POV and running with it to show how silly it is.



-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 10:27 AM on June 27, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:54 AM on June 27, 2009 :
Derwood
So you are assuming that an intelligentce encodes genes.  And employing this wholly unfounded, unsupported assumption as a given, you then conclude what you assume.


And you assume that no intelligence was needed to encode the genes.


Yes and no - when we use the term "encoded" we are employing a post-hoc rationalization of what we observe.
It is metaphorical.

When a scientist refers to a gene 'encoding' something, they are referring to the observable interactions between the molecules, not some grand plan.


And employing this wholly unfounded unsupported assumption as a given, you conclude what you assume.

You are projecting the very basis for your position onto me.

For your position to have merit, we would have to know that a human 'encoded' genes, i.e., somehow made the nucleotides line up in a particular order such that a particular protein was ultimately produced.
Otherwise, you are just relying on a rather extreme application of an analogy as evidence.  


There, now perhaps you see what I mean by assumptions and intepretations of the same evidence in different ways.

No, I see what is meant by tautologous reasoning and employing analogies as evidence and a bit of transference.
 
Are you indicating that genomes were encoded by humans?  That is, in a logical sense, the ONLY thing you can be saying, for we really have no way of knowing how a non-human entity would "design" anything.


I would imagine that that is because we don't know everything.
No there is nothing logical about what you are saying and how do you know what a non-human entity could or could not design.

I am not the one declaring that because humans design things therefore genes were designed.  
I am not the one constraining an unknown entity's abilities to an analogy of what humans do.
IMO, if there were an 'intelligence' capable of doing the things the ID/creationism movement says it can do, then to constrain it to operating just as we do is the height of an argument from ignorance and arrogance.
YOU are claiming to know how this entity (your 'god') operates, I am not.
If I were gullible enough to accept the analogy-as-evidence presented by the creationist information mongers, I would be forced to conclude that I do not know one way or the other, for it is almost trivial to demonstrate purely natural forces acting upon genomes.

Are you the repository of all information?
Then you must be God! Hello!

Again, I am not the one presuming to know within what constraints your god operates.  
YOU are limiting your god - i.e., acting as the repository of all information - to acting in ways similar to what humans would do.

I am not.

To imply that a "Designer" if life would necessarily be limited to what humans can do is the height of arrogance, it seems to me.


Who said he is limited to what humans can do. Did I say that - no. Did you? And if so, why would you say that?


It is implicit in the IDcreationist "information" arguments.  Genomes have been analogized to computer programs - surely a human activity.  


Oh yes, man, with a brain that operates from neuronal material and trillions of synapses that happened together by chance with no plan and no organization.

Nice strawman.


What strawman?
The strawman is that the synapses 'happened together' by chance.
Synapses form in part via interactions with other cells and in response to concentration gradients of hormones and other extracellular chemicals.
It is not 'chance.'


Aren't you advocating that the best mistakes (mutations) selected for (natural selection) somehow put a brain together?

To put it in a very crude form, I suppose.  But we do not think that a human brain - or any brain - was put together all at once by 'random chance'.  But that has nothing to do with synapses.

Yet, one could, with the proper investigative tools, actually find the author (or his or her remains or at least information about their fate) were they to look.  Must be why IDcreationists don;'t bother looking - they know they can't find anything.


We see the evidence for creation all around us then we look for the author and find him!

I took a creative writing class as a freshman.  There was an older woman in the class who liked to write poetry.  One of her poems was titled 'The Grandeur of God', and it rambled on about trees and rainbows and sunlight and laughter and so on, and the closing line was something like 'all attesting to the grandeur of God'.  
To say that evidence of creation is 'all around us' is the argument of a child or a simple old lady.  It is the argument from awe.

You, on the other hand see mutation and selection all around you and imagine that that is how it happened and then you don't bother to look for your creator because you're sure he doesn't exist. Is that clever?

Not clever, it is rather mundane actually.  It follows from observation, not from a predetermined conclusion premised on years of Sunday school and browbeating by parents, clergy and peers.

While I considered myself a Christian until I was about 20 - I recall saying to the first atheist I ever met "How can you NOT believe in God?" - his answer, "How can you BELIEVE?" , played a pretty big role in my de-conversion  - my work in evolutionary biology played no role in my rejection of religion.  Point being, I never sought to reject a 'creator' in science.


There are several ways that we humans (and non-human animals and even plants) convey information that do not require the written word.


Yes I'm aware of that, and God does it with DNA messaging.

What is your evidence for that conclusion?

I know what it is - it is a sill analogy.

What is the material medium for spoken 'wisdom'?  Air?


How do we know that it requires a medium?

Are you telepathic?

Maybe it is electromagnetic and can travel in a vacuum.

It would still have a medium, no?

And if the information is a function of the medium, then the medium dictrates the information.


Doesn't logically follow, sorry. Does a DVD disc dictate what is put on it?

And herein lies the rub - DNA is not like a DVD.
Analogies are apparently the creationist's best friend, but it is a bad friend to have, because it blinds you to the reality of the situation.
Mutating a gene DOES change the 'information' in DNA, therefore, the information IS a function of the medium in a genome.

It is not only logical, it is true.



No 'designer' needed.


Sloppy logic. Stupid answer. Try rethink that one.


This from the fellow who concludes that God wrote a message in DNA based on an analogy...

The misplaced condescension of the creationist is legendary.


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 10:51 AM on June 27, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

And, in a sense, all information is divine, so everything is God. But i'm sure you won't like my way of being a believer...
The thing is I don’t really understand it. I know that’s the way New Agers think and I was one of them myself at one stage
Sorry. I don't know much about that. I made my mind pretty much on my own.
–God is everything and everything is God and all of that.
Hum... Sounds about right to me.
I went to the seminars, sucked it all in, meditated, used mindpower and mind workshops, did mind trips and diagnostics for medical conditions.
Oh... I discovered meditation on my own, and don't know anything about the rest of the stuff you list.
I really loved it, spent a lot of money on it but I guess someone somewhere saw me going down the garden path and prayed for me.
Intercessory prayer has had no demonstrable effects.
I was lucky, now I hear “there is no reality” and “everything is one” and I feel nothing but horror for where I might have been.
Well too bad. Because there's no reality. And everything is one.

I seriously can't figure out what you mean by "information". I honestly believe that you don't know, but you think you know.
By information, I mean that the DNA is like a letter, an intelligent letter that gets transcribed onto RNA and the RNA then translates those letters into a functional protein that get folded into a specific shape that is made to perform a specific function by interrelating with other coded proteins in the correct numbers and shapes to make something purposeful occur in the body.
So how can you tell? You just look for purpose, and then you know? But how do you know how to find "purpose"? You don't even know if rabbit warrens has any.

I don’t believe that such a thing is purely a matter of chemistry nor is it according to people like Dean Kenyon who used to be a foremost authority on such chemical inter-relations.
I don't know anything about him. I don't care much either, but if i have to guess i'd say that an educated person is more likely to become a creationist after going gaga. An uneducated one, at any moment.

I believe that that DNA information was put there by an intelligence for a purpose and that the message is separate from the material carrier just like a DVD disc is separate from the information that it conveys.
You can take any rock and say the same thing. You leave it on the ground and it leaves a cameo. So it contained information.
The only difference would be the purpose, right?
How_can_you_tell?
Do you see purpose in a rabbit warren? Or in ant galleries?

I’ve said before that DNA has to have 5 levels (statistics, semantics etc) that have to be present to constitute information. DNA has all 5 levels and thus fulfils the criteria for information.
I don't know what you're talking about.
Can you explain the semantics?

Do animals need information to produce venom?
Yes they do. The proteins of the venom are coded for and have a specific purpose, they didn’t just fall together by chance and chemical attractions.
Ok, that's a real answer. Thank you.
Do you know or care if you're alone in this position? Perhaps you checked carefully before stating it. Did you?
They are for that animal’s protection.
Deadly weapons as protection? Tissue liquefaction as protection? Shark teeth for protection? Against what??? Against other armed animals?? So Yahweh put weapons in animals to fight animals with weapons, because he know everything would get screwed?
The emerald wasp has two kinds of venom. One is a paralyzer, and the other one blocks a neurotransmitter that allows the cockroach the impulse of escaping. The first is to allow the wasp to carefully deliver the second, that goes to the insect's brain. Then the roach becomes docile. The wasp leads it to a hideout and puts some eggs in it. They hatch, and know how to eat the roach in order for it to stay alive for one week.
Do you believe that Yahweh did all that?

Purpose implies intelligence and a plan.
Yes, of course. But how can you tell? You're not referring to anything factual. Just more abstract concepts.
Do you see any purpose in a beaver's dam? I'd say that the beaver's purpose was to contain the flow of water (depending on your definition of "purpose").

Only that Yahweh wouldn't produce information so ugly. And that the Bible says animals lived in harmony.
There its your picture of Yahweh that is idolatrous.
Yeap. And it's shared by many creationists.
You give him characteristics that are not his.
Says who?
Maybe he produced the information but it wasn’t meant for evil, only for protection.
Evil?? Are you saying that animals do evil??

Had you not said in the past that animals have weapons "because they have to eat"? Now you say "protection"?

Just like we have science, we have brains, we make evil things with our brains but generally that is because we don’t listen to God, we are just fighting to survive like in the evolution worldview;
Sorry. I don't believe in "evil" since i was 11 (maybe 10).
we are just higher animals with no moral standard and we just do what we do for whatever reason we do it.
I don't know what "higher" means, but we are very moral! It's in our biology. An evolved trait. Who says we're not?
However we're not special in this. There are other moral animals. Some even have taboos.

Animals did live in harmony but after that they didn’t. That was the fall of creation, when everything went wrong after man decided to ignore God’s instructions and do it his own way.
God made everything, and everything went wrong. And you manage to believe that God is perfect. Very weird.
It’s like what teenagers do when their parents tell them ‘don’t’.
No, it's not like that. Because parents don't decide their offspring's traits. And the good ones don't fill the place with temptations that will doom them.
They tell their kids things for their own protection and because they love them and the kids think they’re clever and they don’t listen. They know better.
It's not the same either. Kids often do know better than their parents. I did. And i hope my kid does too.

I have built some degree of self-confidence that tells me that i'm probably right.
That’s probably what Adam and Eve had when they decided not to listen.
Nah. Adam was a drooling moron, according to a literal interpretation of the Genesis. If the creator of everything told me something to my face, i'd listen.
And if Adam was easily tempted, it was because Yahweh wanted it that way.

It's actually a lovely story, but if you decide to make it literal it becomes very dumb. You guys ruin it!

They went from God’s wonderful creation to God’s disobedient know-it-all better than God brats.
Yahweh made those brats. He designed them. So let's not blame them.
You say "free will". But on top of that Adam was curious, weak, not very bright, and lacked some vital information (not to mention that the tempting fruit was in the middle of everything). And Yahweh was the only responsible for all that. A literal interpretation of the Genesis makes Yahweh a douche.

Not to say that it’s necessarily wrong to go with your gut feeling on things –sometimes that’s right but it works much better when you have an instruction manual of right and wrong that’s in sync with your God-given conscience.
Your manual says that marrying your rapist is good, and shaving is wrong. I strongly believe that i know much better than that.
That ‘s the best combo for the best results.
That would be disgusting.

No. A chair doesn't make itself. But we're talking about Evolution here, so this is not relevant.
Can anything make itself do you think?
No, i think not. But we're talking about Evolution here, so this is not relevant.

After having studied (a little) and meditated (a lot) on theoretical physics i concluded that matter is information
I agree, only I think that information needs intelligence behind it. Thus matter obviously does too.
Oh, but i agree with that too!

But if we agree, then you must see intelligence and purpose in a stone. Do you?

You appear to agree that information and physical laws must come from God
Yes.
–but back to evolution then…
Then what?
I go to the extremes. Extrema se tangvnt. Everything has a purpose, or nothing does. Everything requires intelligence, or nothing does.

It's not us who refuse to discuss facts.
Neither do we.
Oh, yes you do. You were very reluctant to talk about natural weapons and armors. Only now you're mentioning them, after many requests.

Do you know about some creationist show with Kirk Cameron? They said that the banana is the atheist's nightmare, because it shows God's plan. That it's delicious, has the perfect shape to fit our hand, easily opened, etc. So that means creation.
(I know you have a slow connection, but i'll post it just in case you want to see it http://www.youtube.com/watch?v=Y4yBvvGi_2A )
Do you doubt that they will not discuss what bananas were like before human domestication?
They looked like this:

Our domestic bananas can't even reproduce by themselves anymore. They were selected to be tasty, not to be good at reproduction.
A pink banana (just for fun):

A japanese "fiber banana":


The same goes with corn. The domesticated varieties have lots of duplicated genes. And yeah, gene duplication does add things. It adds even more if the duplicated gene mutates.

Reasoning, intelligence, consciousness, they are all divine in nature.

But if you ask where did they come from, you're talking about something historical. The answer to that one would be "From nature" then.
Yes they are the immaterial portion of us.
Such a distinction is yet another glitch in our brains. We were selected to see a distinction between mind and matter. It was a successful trait, that happens to make you see something that's just not true. Just like the moon appears to be bigger when close to the horizon.
It's not like ordinary optical illusions. It comes from a glitch in our brains that make us believe that things in the horizon can be much farther than in the zenith.
Like this:

We naturally believe in a firmament not very far.
Now why would an intelligent creator put such a glitch in our brains?

What does ‘from nature’ actually mean –I think that immaterial part of us is eternal and comes from God.
What does "immaterial part" actually mean? Does it change when you pour some alcohol over it?

He just gave us a body to carry the immaterial part around.
If it's immaterial it cannot be carried. If i believed in such a distinction, i'd say that the immaterial stuff isn't bound by time and space (which is a logical prerequisite to "be carried").

I honestly believe that, again, you don't know what you're talking about.

Whenever you add "random", the answer will most likely be "no".
If it’s not random, it is purposeful,
Come again? Why?
but you deny that it is purposeful so it must be random? Where am I going wrong here?
Here:

# Excluded Middle (False Dichotomy, Faulty Dilemma, False Dilemma, Bifurcation):
assuming there are only two alternatives when in fact there are more. For example, assuming Atheism is the only alternative to Fundamentalism, or being a traitor is the only alternative to being a loud patriot.

The informal fallacy of false dilemma involves a situation in which only two alternatives are considered, when in fact there are other options.

That kind of harmony should mean that i'm right, or that there's some powerful uncanny force trying to deceive me.
I would go with the powerful uncanny force that is trying to deceive you. But you don’t believe in him nor in his creator.
Is it that uncanny force the one that makes Evolution work?

A weird force that tends to affect the smart people first...
A weird powerful evil force that tends to affect prideful people. Unfortunately too many clever people fall into this category. It’s like imagining that you could take God’s place because of your cleverness.
Well that seems pretty stupid. And you're aware of that.

So hey! You're smarter than the Devil!

You don’t need to listen to Him because you’re far too clever.
Well, we don't follow the Bible's instructions because we're too clever.
My children think like that too sometimes.
And sometimes they'll be right, and you'll be wrong. You don't know what God would say. You believe that it's in the Bible, with no good reason.

Evolution can explain everything.
Perhaps it can, but is it true? Not everything has only one possible explanation.
Of course not. The Flying Spaghetti Monster could have made it all, and put fossils and stuff to test our faith. That is another possible explanation. And i don't care about it because it's useless.

Timbrx and you disagreed on some important issues. Like vestigiality!
That was an accident. You don't like disagreeing.
Sorry you feel that way. I don’t know where you picked up a contradiction between our views.
You don't?
Let me remind you:

Posted by Lester10, at 07:24 AM on April 5, 2009
How did i guess that the legless lizard would have vestigial legs when i was a teen and didn't know about legless lizards OR vestigial limbs? My correct guess made my trust in that consensus stronger.
Nobody has any problem with loss if information due to mutational corruption. The lizard's original information was corrupted.
On the other hand, timbrx says that vestigiality presupposes Evolution. And he opposes the notion that what we call vestigials can have no use.
I asked him a dozen times if he believed my story about the legless lizard, and got no answer that i can recall. But he consistently denied vestigials.

By the way, you didn't even try to deny your dislike of disagreeing. Thanks.

Perhaps it is something we need to look into and clarify. The way I see it, Timbrx and I have one main thing in common and that is that we love the truth.
Would you go with it if it denied Yahweh?
We believe very strongly that evolution is a lie and we are distressed that people are believing the lie.
Nothing to do with the afterlife, right? Just love of Truth. Nothing about fear of Hell or anything. Correct?

Is it possible that we're all going to the same place, regardless of what we believe?

Perhaps it's not even Heaven.


Timbrx basically said that what appears to be vestigials must have some function (however obscure).

Would you say that he's wrong?
No I wouldn’t say he’s wrong.
And i am not surprised.
He may be right. I personally don’t doubt that everything had a function at some stage and was intelligently designed. However mutations may have rendered certain things vestigial in that they no longer function optimally or at all.
I see your point (that still differs from timbrx's). The thing is that it often seems very hard to consider animals keeping functionality while losing their limbs! Unless other things are developed, which goes against your beliefs.

Mostly the vestigial argument tends to be based on ignorance though. If you don’t know what it is, it must be vestigial though I think most scientists have got over that now as it becomes increasingly apparent that they were basing that supposition on a belief in the principle of evolution and that everything seems to have had a finction after all.
You "think", so you don't have to back it up.

We base our argument on the principle of creation or “God doesn’t make junk” so we assume function first –that tends to fit better with reality and helps science go forwards rather than backwards.
I believe that God doesn't make junk too. I also believe that He doesn't make anything.
Only he who needs does.

ID implies that some intelligence designed venoms, fangs, claws, etc.
So does creation.
So you say. Not everyone thinks like you do. Most of the creationists i've debated with say that those are the result of devolution. That God wouldn't do such an awful thing.

Behe thinks that malaria was intentionally designed. I could be wrong, but i bet you don't.
I haven’t heard that and I don’t know what his reasoning might be.
Why would you care if it wasn't Behe?
Why would you doubt it if it wasn't malaria?

This is my point. You don't like disagreeing with another fellow creationist.
But you don't like for malaria to have ben designed by your god.

That doesn't look like love of truth at all.

I accuse you of playing deaf with many of my questions, and not because they were too many, but because you didn't know what to say. That's dishonesty.
I would think it would be honest not to say anything if you know nothing about something.
When you're a part of a discussion, it's not.
I don’t know what sorts of things you are referring to though. It’s not intentional anyway.
Hum... Ok... But it took you ages to discuss venom. And i still can't get you to discuss rabbit warrens.
I think it is far more likely that I was short of time and answered the more important things (in my estimation) first. I often don’t answer your whole thread, I just pick things. If I answered everything, I would be here all day answering one post, like I’m attempting to do today.
I understand.
I think your typing must be quicker than mine or else you have lots of spare time.
Sometimes i have devoted my entire spare time to this, but not anymore (got some new activities). Oh, and i type really fast.

I'll pat your back too whenever you surprise me with something of worth. Have i never done so?
Not that I recall
Nah, i'm sure i have... I remember that you have surprised me more than once.

All science is observable, or none is.
All science should be observable but evolution isn’t which is why it isn’t science.
We don't observe atoms either.
And if you say that we observe their effects, we observe the effects of Evolution too.

Are you not ashamed? Not one bit?
No. I’d have to find out why they think what they think. Remember they’re interpreting the evidence and they have reasons for their interpretations that I’d want to hear in order to decide what I think.
But they were wrong! All of them, according to us. Most of them according to the most benign position you could ever take.
Their position is that the distinction is obvious, so i'd go with "all of them were dead wrong". I don't see how you can get any wronger.

We say "It's a puzzle", you say "There's no puzzle", and you can't put the pieces together.

Now that wasn't back patting, was it?

I also discuss a lot with Fencer (who is an evolutionist, in spite of his nickname).

I have had discussions with others too. Even with Derwood.

So i hope you show some honesty and take that back.
You always call it honesty when it means agreeing with you.
I don't understand what you're saying. I'm honest when i say that you are right when i think you are, even in the smallest of points. I do it all the time actually, but the points you're right about usually bear no consequences, so you don't appreciate it.

I thought timbrx was right about a point he had made regarding the vestigial muscle that derwood posted about, and i was wrong, so i took it back.

What i mean is that at least i have no problem saying "You're right". You do. And you call us proud.
In this particular case, I take that back.
Thank you! ^_^
I appreciate it.

In others, I don’t, but in both types of cases, I am being honest. Now can I have my pat on the back?
Thanks. That was pretty honest. I don't quite understand the reserves you make, but the taking it back was honest nevertheless.

There has been no sustainable alternative to naturalism. Ever.
But you do admit that you presuppose naturalism, don’t you. You think it is right but please admit that you do do that.
Well... I would, if i believed that there was any other option... By saying that i presuppose naturalism, you're saying that i had a choice (i think), and i didn't.

I think i realized that there's no choice to naturalism. I wouldn't even give it a name. It's nothing. "Naturalism" means nothing to me.

Supernaturalism = a glitch in our brains.
Naturalism = nothing.

I'm not quite comfortable with your tagging me a "naturalist" only because you pay a glitch in your brain too much attention.

I don't even like to be called an "evolutionist". Or a "darwinist".
If your Bible denied relativity you'd be calling me an "einstenist", and would sound just as silly to me.

I show you pictures, you shut up.
I describe parasites, you shut up.
I name claws, venom and fangs and you shut up. I say that if the legless lizard got this way just by losing stuff it implies that devolution can imitate creation (the snake), and you shut up.
Sometimes I don’t even read your posts because I just see long and laborious and I know my time is limited and so I’m afraid, as much as I’d love to, it can be too time-consuming.
Sigh... I understand...

As i've said before, i was recently the minority in another forum (in spanish, which was very good for my mental RAM and allowed me to write even faster), and i could barely keep up to the attacks being directed to me.

By the way, i was just explaining evolutionary biology and it's applications to human behaviors in a forum about psychology, and some of them got really mad!
Like you, they feel their freedom and responsibility threatened by biology. So if you people want to recruit new creationists, go to a psychology forum.

I’ve enjoyed having the time to answer point for point this time but I don’t always have the luxury. My apologies for all times past where I have offended you by denying you an answer.It was not intentional.
That's really sweet! Thank you!

I wish you could do ‘short’ but I’m afraid that is not your way and that’s fine.
I have a very hard time at that...

Interpret claws, fangs, venom, etc, please. How did they get there?
They were created for self-defence in a world that is not perfect? Apparently God knew in advance that his creation wouldn’t be inclined to listen to him so I suppose he programmed in everything they would need to survive in the niche they were created for.All animals have to eat after all and they at least need a fighting chance. Apparently the bigger plan made it worthwhile.
I think that makes no sense. No animal would need to defend itself if the rest of the animals lacked weapons too.

How do you think those sorts of specific proteins evolved? Did the odd random mutation just happen to add up to something useful piece by piece?
It depends on what you mean by "piece", but yes, basically that's correct.
How did natural selection select for something that would need to be built up piece by piece, mistake by fortunate related mistake?
Do you remember tetrachromacy?
Only women can have it, because it happens as a product of a mutated gene for perceiving green or red, while maintaining the intact gene for perceiving green or red in the other chromosome.
The chromosome is X, so males can't have this advantage (you need two X).
It's a very simple mutation. It happens during meiosis. It's not an advantage because those women can have colorblind sons. But such a mutation could happen in another location, and it would be just fine. And it could get duplicated (another ordinary mutation), and the next thing you know is that the whole species can now see four colors.
We could do it ourselves (it doesn't sound hard to do), replicating the same mutations we see in nature, but you'd still see it as evidence for ID.

When i say "tons of evidence" i mean it.
All evolutionists say that but whenever they find a new ‘missing link’, it is the final definitive proof of all time, incontrovertible, unmistakable, only stupid people won’t understand why, one in a million, absolutely definitive –and we still don’t believe it. Why do you think that that is?
Emotional investment.

Creationists (even if they consider themselves successful about these) can only name a few cases of what they call "irreducible complexity".
No they cite particular pathways and parts by way of demonstration.
Oh... What else do they have?
They have done knock-out experiments on various pathways but obviously not all. The examples are endless but they only use particular ones by way of illustration of a concept.
Where can i find out more about it?

Thanks for answering. I'll reread this and see if i can make it any shorter...
Done. Not much shorter, i'm afraid.


(Edited by wisp 7/3/2009 at 9:27 PM).


-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 9:21 PM on July 3, 2009 | IP
waterboy

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Why is everyone making such hard work of this?

The word 'information' has many meanings depending on context.

One definition requires a sender-message-recipient while another simply requires a pattern and an intelligent observer.

The existence of a regular pattern, no matter how complex, does not necessarily consitute information. An intelligent observer may draw useful conclusions from any pattern in which case we might say that the pattern 'contains' information. This is NOT the same sort of information as a 'coded' message which implies intentional coding and transmission of 'information' to an 'intended' recipient.

There is no 'coding' taking place in the replication of DNA. It is simply that.. 'replication' with noise.  The DNA 'HAS NO PURPOSE' but under the right conditions it will participate in certain 'chemical' reactions.

As 'information' DNA is not coded (it is only replicated) and is not 'intentionally' transmitted to any identifiable recipient.  Observation of DNA by 'intelligent' observers suggests value, utility and purpose to the observer where none exists other than in the mind of the observer.

The flaw in the 'information argument' is that it is asserted that a certain pattern constitutes information based on one definition of informations and then draws conclusions as if the word 'information' always means all possible meanings of the word. It goes like this: if a pattern is observed and the observer can make use of that pattern then the pattern-observer-utility complex exists satisfying one particular definition of information. Another definition of information (relevant only in entirely different contexts) requires a sender to encode a message and initiate a transmission of that message to one or more recipients. The elements of the latter definition are then erroneously applied to the former context producing the fallacious argument that the pattern has a 'sender' and is a 'coded message'.

The argument is fallacious and the purveyors of this argument are either ignorant or devious.


-------
Charis kai Eirene
 


Posts: 218 | Posted: 04:46 AM on July 4, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Intercessory prayer has had no demonstrable effects.


According to whom?

Because there’s no reality


What?

So how can you tell? You just look for purpose, and then you know? But how do you know how to find "purpose"?  


It’s usually pretty clear. Blood clotting agents in blood pull together to stop blood flowing out of a wound. We need them all, they work in a specific order. Want to live, don’t want to bleed to death. There’s purpose. Immune systems senses danger, makes white blood cells to agglutinate foreign proteins, sends out macrophages to mop up mess –there’s purpose. Person goes outside to look for something –there’s the purpose, they are looking for something. We all know what purpose is. Lets not let ‘science’ balls up our common sense now.

You don't even know if rabbit warrens has any.

I think the rabbits live there – so they have purpose? A home? Haven’t given an especial amount of time to musing on the rabbit warren problem.
i'd say that an educated person is more likely to become a creationist after going gaga. An uneducated one, at any moment.

You would say that, but you might be wrong of course. I don’t know. You think being a creationist is dumb and gaga so you would think so. That would be intuitive for you. You love that intuition of yours but you need to be discriminating and realize the origin and purpose of your judgements.
You can take any rock and say the same thing. You leave it on the ground and it leaves a cameo. So it contained information.

No it has to be a definite message with a purpose and usually a recipient not just something that might or might not be a message depending on how you look at it.
I’ve said before that DNA has to have 5 levels (statistics, semantics etc) that have to be present to constitute information. DNA has all 5 levels and thus fulfils the criteria for information.
I don't know what you're talking about.
Can you explain the semantics?

Semantics is the information of meaning and implications. It requires determining the meaning, message and implications of the words and sentences. It is not helpful to give a message if it cannot be understood. The communication of information would be stopped without the use of good semantics.
Do animals need information to produce venom?
Yes they do. The proteins of the venom are coded for and have a specific purpose, they didn’t just fall together by chance and chemical attractions.
Ok, that's a real answer. Thank you.
Do you know or care if you're alone in this position? Perhaps you checked carefully before stating it.


Venom has a purpose and a function. It poisons the recipient not the producer; it is stored specifically to be used in defence or for feeding. It is coded for in the DNA and is produced and held in a portion of the anatomy that can deliver its intended action. I’m sure I’m not alone in this position. How would you like me to check carefully. Like you, I sometimes resort to what I consider to be common sense or intuitive knowledge. If the logic escapes you, tell me why.

So Yahweh put weapons in animals to fight animals with weapons, because he know everything would get screwed?


No maybe he knew everything needed to survive and eat and so everything had to be provided with the means to that end. How they use those survival means is entirely up to them much like how we use our brains is up to us. It’s a choice for us; for them it’s instinct that they are programmed with for their survival.

Purpose implies intelligence and a plan.
Yes, of course. But how can you tell? You're not referring to anything factual. Just more abstract concepts.


But we all understand it; it’s really not difficult.


Evil?? Are you saying that animals do evil??


No but we might perceive what they do to be evil. If a snake bites and kills somebody, it might be considered to be evil but it isn’t if it is a programmed survival instinct in that animal. Only humans have real choice.

Had you not said in the past that animals have weapons "because they have to eat"? Now you say "protection"?

Weapons can be protection or for collecting food which is not protection but survival. Every animal has enemies that want to eat it so protection is a good thing. That way it gets a fighting chance.
Sorry. I don't believe in "evil" since i was 11 (maybe 10).


Why because you convinced yourself that there is no reality?

we are just higher animals with no moral standard and we just do what we do for whatever reason we do it.
I don't know what "higher" means, but we are very moral! It's in our biology. An evolved trait. Who says we're not?


The first quote refers to evolutionary beliefs, not my opinion. ‘Higher’ I would say refers to our ability to think and reason which sets us apart from the ‘other animals’ as evolutionists like to see us. And how do you know it’s in our biology? Who says it evolved? How can you tell? There are two possibilities –it evolved OR it is built into us by our designer. Even if you don’t like to believe that the designer exists nonetheless you must acknowledge that both possibilities are feasible and should not be prejudicially excluded?
God made everything, and everything went wrong. And you manage to believe that God is perfect. Very weird.


Everything went wrong because we were given choice and most people want to be God of their own lives; they don’t want to listen to God’s advice about how they should live and what better choices are. Just like children with their parents, we start out listening and at some point we try to exert our will on our parents. We think we know better and their advice for how to stay out of trouble falls on our deaf and ‘clever’ ears.In the same way, God is immortal and all-knowing and he gives us advice as well as the choice to follow or not. He knows that his advice is the best advice because he is eternal and immortal but he doesn’t want robots so he doesn’t force us. That makes sense to me. I don’t want to force anyone to be my friend either. If I try to force them , it won’t be real, they’d be doing it because I want them to and that won’t last. Nobody wants a robot for a friend.

No, it's not like that. Because parents don't decide their offspring's traits. And the good ones don't fill the place with temptations that will doom them.


Neither do they remove them all. They teach their kids right and wrong and what to do and what not to do and if there are temptations are in the way, they teach their kids to resist temptation that’ll have bad consequences and often kids need the consequences to learn the lessons. Some kids use their brains and think ahead and others rush headlong into danger ignoring the parental advice and hurting themselves in the process. The instructions are there for our good, not to control us for fun. We can do what we like, but there are consequences.

It's not the same either. Kids often do know better than their parents. I did. And i hope my kid does too.

Well that’s not a great situation and that’s not the way it’s meant to be but I see it everyday. Some kids get to be parents to their parents when the parents were supposed to be there to look after them and give them good advice for their lives.
My parents know better then me but I didn’t always feel that way. That’s the way it should be and I think it’s easier to trust God if you have the experience of trusting your parents. Some people don’t trust anyone but themselves because they’ve never been able to. Life is really messed up these days; it’s upside down and not the way it was designed to be and it’s all a consequence of man ignoring God and doing it his own way.
The day your kid decides that you’re a fool and he knows better especially when you are giving him good advice that is for his own protection that you would like him to follow, you will feel pain –only because you love that kid and want what’s best for him. That’s how God must feel when we walk away.

If the creator of everything told me something to my face, i'd listen.
And if Adam was easily tempted, it was because Yahweh wanted it that way.


I don’t think you would listen. Or you might for a while until you got overconfident and decided to go it alone. The Bible doesn’t say how long it took Adam and Eve to get delusions of grandeur. It sounds quick but it might have been 100 years of listening before they decided to go it alone on bad advice from their enemy.

Can anything make itself do you think?
No, i think not. But we're talking about Evolution here, so this is not relevant.


There we go.How is it that evolution just breaks all the rules that everything else must follow?

But if we agree, then you must see intelligence and purpose in a stone. Do you?


No but I don’t see information in a stone. So I spose I don’t see matter as intelligence only as the product of intelligence.

I go to the extremes. Extrema se tangvnt. Everything has a purpose, or nothing does. Everything requires intelligence, or nothing does.


So I presume in that case you have decided that nothing has a purpose?

Oh, yes you do. You were very reluctant to talk about natural weapons and armors. Only now you're mentioning them, after many requests.


I was probably just concentrating on answering other things that interested me more. Maybe when you mention it enough, I finally notice it.

The same goes with corn. The domesticated varieties have lots of duplicated genes. And yeah, gene duplication does add things. It adds even more if the duplicated gene mutates.


Adding the same info twice is not like adding information –it’s just repeating information and if the duplicated gene mutates, something is lost, not added.
It’s a fallacy that mutations add information, they only mess up information or cause loss of information. Of course for evolution to work, you need to imagine that they add information but they actually don’t –you need to look at the experimental evidence to decide. It is possible for evolutionists to research mammoth quantities of mutations on animals, plants and humans too. Thinking scientists know that new species would have to appear rapidly or they would die. Living organisms are too complicated to live with only a portion of their revised organs in place. So have a look at these research centres:

Hiroshima –not one of them evolved into a different species nor did they improve in any way.

Chernobyl – evolutionist’s paradise –covers a wide area. Plants sickened and died, animals badly mutated (deformed), no eyes, deformed mouths, mutated skulls, fetal abortions ongoing, stillbirths and infant deaths.Approximately 10 000 deaths to date. Not one new species, Not even one new organ!

“Lethal mutations outnumber visibles by about 20 to 1. Mutations that have small harmful effects, the detrimental mutations, are even more frequent than the lethal ones.” AM Winchester; “Genetics”

“Each mutation occurring alone would be wiped out before it could be combined with the others. They are all interdependent. The doctrine that their coming together was due to a series of blind coincidences is an affront not only to common sense but to the basic principles of scientific explanation.” A.Koeslter –The Ghost in the Machine” p129

"The question is then, can random sources of energy as represented by radiations or mutagenic chemicals, upon reacting with the genes, cause body changes which would result in a new species?” Lester McCann “Blowing the Whistle on Darwinism”

A nascent organ is one that is just coming into existence, none has ever been observed.

Enough for today!Got to go.
 






-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 08:22 AM on July 4, 2009 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Adding the same info twice is not like adding information –it’s just repeating information and if the duplicated gene mutates, something is lost, not added.


I'm having a hard time taking you seriously right now. It's easy as pie to demonstrate an increase in "information":

Original strand of DNA:

AGTCCTAGCTACCTGA

Duplicated strand of DNA:

AGTCCTAGCTACCTGAAGTCCTAGCTACCTGA

Mutated duplicate:


AGTCCTAGCTACCTGAAGTCCTAGCTACCTGC


Now compare the two:

Strand 1: AGTCCTAGCTACCTGA

and

Strand 2: AGTCCTAGCTACCTGAAGTCCTAGCTACCTGC


When you tell me that Strand 2 doesn't have anymore information than Strand 1, I don't buy your sincerity. This kind of mutation can be demonstrated with an English sentence just the same:

Original strand:

I have a cat.

Duplicated strand:

I have a cat. I have a cat.

Mutated duplicate:

I have a cat. I hate a cat.


I changed one single symbol, and that all of a sudden provides completely new meaning to the strand of sentences. Unless you think it was already apparent with the sentence "I have a cat," you would never have been able to conclude that "I hate a cat" as well. Why? Because that information there in the first strand.

Likewise, AGTCCTAGCTACCTGAAGTCCTAGCTACCTGC, could code for something that AGTCCTAGCTACCTGA never could This kind of thing happens millions of times in every new living organism. We've documented it. We can measure it happening. When you say that DNA cannot account for new codes, you are simply wrong.

(Edited by EntwickelnCollin 7/4/2009 at 11:01 AM).

(Edited by EntwickelnCollin 7/4/2009 at 11:02 AM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 10:59 AM on July 4, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Adding the same info twice is not like adding information –it’s just repeating information and if the duplicated gene mutates, something is lost, not added.

No, nothing is lost because you have the original sequence that was duplicated that did not change and you have the duplicate sequence that did change.  Nothing is lost (you still have the original) and information is increased because you have the mutated sequence that wasn't there before.  It's pretty straight forward, don't know why you can't understand it.
 


Posts: 1664 | Posted: 5:08 PM on July 4, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

A mutation in a duplicated strand is as good as having an extra finger coded for, so now you have 6 fingers instead of 5 only the extra finger is a mutated one. The code of the DNA has been altered and is no longer good for a normal finger.

Mutation is not generally something good. In most cases it is something bad and it does not even begin to explain the amazing supposed positive changes attributed to evolution even given billions of years. For every one 'good' mutation, 99 bad ones occur so what does one do with the bad ones while retaining the good one? What about mutations causing problems in interrelated systems so a good effect in one may be combined with multiple bad effects in others.

As far as meaning goes -"I have a cat. I have a cat" is like the extra finger. I hate the cat is the mutated meaning. Not only didn't it mean to say that but it probably and more likely would change to something like 'I have a cat. I eave a cat" because a random mistake is most unlikely to turn out to have any meaning at all.

The story is illogical.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 09:32 AM on July 7, 2009 | IP
Fencer27

|      |       Report Post




Junkie
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:32 AM on July 7, 2009 :
A mutation in a duplicated strand is as good as having an extra finger coded for, so now you have 6 fingers instead of 5 only the extra finger is a mutated one. The code of the DNA has been altered and is no longer good for a normal finger.


This is a little off topic but we have observed humans, through mutations, to gain fully working extra digits on both hands and feet. How is that a negative mutation? Or how about the Hemingway cats?

Mutation is not generally something good. In most cases it is something bad and it does not even begin to explain the amazing supposed positive changes attributed to evolution even given billions of years. For every one 'good' mutation, 99 bad ones occur so what does one do with the bad ones while retaining the good one? What about mutations causing problems in interrelated systems so a good effect in one may be combined with multiple bad effects in others.


How many times do I have to tell you, the vast majority of mutations are neutral, not negative. What determines this is the environment. What could be beneficial in one environment could be harmful in another.

However I think you bring up a good point, when good mutations can be combined with bad ones, what happens then? The answer is that genomes are passed down from generation to generation. If the genome as a whole is beneficial than the chances of it surviving until reproduction are increased. If the bad mutations outweigh the good ones, than it is less likely that that genome will be passed down.

As far as meaning goes -"I have a cat. I have a cat" is like the extra finger. I hate the cat is the mutated meaning. Not only didn't it mean to say that but it probably and more likely would change to something like 'I have a cat. I eave a cat" because a random mistake is most unlikely to turn out to have any meaning at all.


This is where you need to leave the analogies behind, because I don't think they will do anything but confuse you. There are only 4 (5 if you want to count U and T as separate, but their chemical structure is so similar we can treat it as 1) letters in RNA/DNA, not 26. And There are multiple codons for the same protein. So you could literally change a codon through mutations and it will still code for the same protein as if it never mutated.



-------
"So in everything, do to others what you would have them do to you, for this sums up the Law and the Prophets." - Jesus (Matthew 7:12)
 


Posts: 551 | Posted: 01:10 AM on July 8, 2009 | IP
waterboy

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Lester

In "I have a cat. I eave a cat." nothing is lost in terms of information or meaning. Its a neutral change. All that has happened is that some 'junk data' has been added which might even turn out to be meaningful one day with further mutation (I leave a cat) or with changes in language.

How about this situation:
"I have a cat."  ->  "I have a cat. I have a cat." ->  "I eave a cat. I have a cat."
In this case the original string mutates but the meaning is still not lost because we now have a backup.  NEAT, isnt it?

As Fencer has pointed out, mutations are common and mostly neutral. Have you noticed how much junk DNA is found within the genome?  Perhaps most new mutations tend to go into the junk pool or become unexpressed recessives.

NEAT! Maybe mutation works after all!




-------
Charis kai Eirene
 


Posts: 218 | Posted: 02:25 AM on July 8, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

A mutation in a duplicated strand is as good as having an extra finger coded for, so now you have 6 fingers instead of 5 only the extra finger is a mutated one. The code of the DNA has been altered and is no longer good for a normal finger.

You're changing the subject because you know you can't win.  You originally said:
"Adding the same info twice is not like adding information –it’s just repeating information and if the duplicated gene mutates, something is lost, not added."
So nothing is lost because we stil have the original, unmutated swquence.  And we have something new (new information) because the duplicate sequence has mutated, become something different.

Mutation is not generally something good.

No, mutations are mostly neutral, as directly observed.  This is another of your many mistakes involving evolution taht you refuse to correct.

In most cases it is something bad and it does not even begin to explain the amazing supposed positive changes attributed to evolution even given billions of years.

In most cases it ISN'T bad, it's neutral in regards to fitness.  And mutations can and do explain the observed and verified changes in life on earth.  Homeobox genes control body plan formation, among other things.  So mutations to this set of genes can radically alter body plans.

For every one 'good' mutation, 99 bad ones occur so what does one do with the bad ones while retaining the good one?

Let's see where you got your statistics for that dumb claim.  And of course we know what happens to bad mutations, natural selection gets rid of them so only the good mutations are left.  this has been explained to you over and over, you simply ignore it because you find it inconvient to your magical beliefs.

What about mutations causing problems in interrelated systems so a good effect in one may be combined with multiple bad effects in others.

If a mutation allows an organism to breed more successfully, then any interrelated mutation that is inherited along with it and doesn't hurt it's reproductive chances is not bad, it's neutral.  Your point is invalid.

Not only didn't it mean to say that but it probably and more likely would change to something like 'I have a cat. I eave a cat" because a random mistake is most unlikely to turn out to have any meaning at all.

Too bad reality disproves your point.  "Probably" and "most unlikey" mean nothing when we see evolution doing just what you say it can't.  Here's an example:
duplication/mutation

"Human adult haemoglobin is actually a composite of four protein chains called globins, knotted around each other. Their detailed sequences show that the four globin chains are closely related to each other, but they are not identical. Two of them are called alpha globins (each a chain of 141 amino acids), and two are beta globins (each a chain of 146 amino acids). The genes coding for the alpha globins are on chromosome 11; those coding for the beta globins are on chromosome 16. On each of these chromosomes, there is a cluster of globin genes in a row, interspersed with some junk DNA. The alpha cluster, on Chromosome 11, contains seven globin genes. Four of these are pseudogenes, versions of alpha disabled by faults in their sequence and not translated into proteins. Two are true alpha globins, used in the adult. The final one is called zeta and is used only in embryos. Similarly the beta cluster, on chromosome 16, has six genes, some of which are disabled, and one of which is used only in the embryo. Adult haemoglobin, as we've seen contains two alpha and two beta chains.
Never mind all this complexity. Here's the fascinating point. Careful letter-by-letter analysis shows that these different kinds of globin genes are literally cousins of each other, literally members of a family. But these distant cousins still coexist inside our own genome, and that of all vertebrates. On a the scale of whole organism, the vertebrates are our cousins too. The tree of vertebrate evolution is the family tree we are all familiar with, its branch-points representing speciation events - the splitting of species into pairs of daughter species. But there is another family tree occupying the same timescale, whose branches represent not speciation events but gene duplication events within genomes.
The dozen or so different globins inside you are descended from an ancient globin gene which, in a remote ancestor who lived about half a billion years ago, duplicated, after which both copies stayed in the genome. There were then two copies of it, in different parts of the genome of all descendant animals. One copy was destined to give rise to the alpha cluster (on what would eventually become Chromosome 11 in our genome), the other to the beta cluster (on Chromosome 16). As the aeons passed, there were further duplications (and doubtless some deletions as well). Around 400 million years ago the ancestral alpha gene duplicated again, but this time the two copies remained near neighbours of each other, in a cluster on the same chromosome. One of them was destined to become the zeta of our embryos, the other became the alpha globin genes of adult humans (other branches gave rise to the nonfunctional pseudogenes I mentioned). It was a similar story along the beta branch of the family, but with duplications at other moments in geological history.
Now here's an equally fascinating point. Given that the split between the alpha cluster and the beta cluster took place 500 million years ago, it will of course not be just our human genomes that show the split - possess alpha genes in a different part of the genome from beta genes. We should see the same within-genome split if we look at any other mammals, at birds, reptiles, amphibians and bony fish, for our common ancestor with all of them lived less than 500 million years ago. Wherever it has been investigated, this expectation has proved correct. Our greatest hope of finding a vertebrate that does not share with us the ancient alpha/beta split would be a jawless fish like a lamprey, for they are our most remote cousins among surviving vertebrates; they are the only surviving vertebrates whose common ancestor with the rest of the vertebrates is sufficiently ancient that it could have predated the alpha/beta split. Sure enough, these jawless fishes are the only known vertebrates that lack the alpha/beta divide."

It happened, it's documented, you're wrong.
 


Posts: 1664 | Posted: 6:11 PM on July 9, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:32 AM on July 7, 2009 :
A mutation in a duplicated strand is as good as having an extra finger coded for, so now you have 6 fingers instead of 5 only the extra finger is a mutated one. The code of the DNA has been altered and is no longer good for a normal finger.


Wow...

Where to start.  First, you cannot duplicate the 'code' for a finger and get an extra finger.  Development does not proceed that way.  
Second, in genetics, it is not good to extrapolate one specific example (even a bad one like your finger routine) to all genes/genomic regions.  It simply does not work that way, either.

In a subspecies of drosophila, an insertion in the promoter region of a gene that "encodes" an enzyme involved in energy metabolism produced an increase in the expression of that enzyme.  This increased enzyme production made this subspecies of drosopila 'immune' to DDT.  
http://www.sciencemag.org/cgi/content/abstract/297/5590/2253

Clearly then your simplistic view of what mutations do is in error, but I woiuld not extrapolate the DDT-resistence in these flies ot mean ALL mutations are beneficial, for I know better.
But creationists seem to think that if they can find an example of a bad mutation - or in this case, concoct a rather silly pseudoanalogy - that they have'proven' that all mutations are bad.

Such hubris is common in Dunning-Kruger types.

Mutation is not generally something good. In most cases it is something bad and it does not even begin to explain the amazing supposed positive changes attributed to evolution even given billions of years.


Argument from personal disbelief.  Not very convincing.
Got any meat for those wild claims?

For every one 'good' mutation, 99 bad ones occur so what does one do with the bad ones while retaining the good one?

Can I see your evidence for that claim?  I don't doubt it, necessarily, but I'd like to see whether that is evidence based or just rhetoric.

What about mutations causing problems in interrelated systems so a good effect in one may be combined with multiple bad effects in others.

What about them?  Evidence or just rhetoric?

As far as meaning goes -"I have a cat. I have a cat" is like the extra finger. I hate the cat is the mutated meaning. Not only didn't it mean to say that but it probably and more likely would change to something like 'I have a cat. I eave a cat" because a random mistake is most unlikely to turn out to have any meaning at all.


Good thing that genomoics is not really all that much like english, but creationists tend not to understand this.  Even the great Dr.Dr. Bill Dembski makes such infantile arguments, so I guess I can't blame internet YECs form doing the same.
The story is illogical.

Right, but an anthropomorphic superbeing (one of several, apparently, see the 1st commandment) willing the universe into existence in 6 days 6,000 years ago and then making humans out of dirt is logical and believable...





-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 09:02 AM on July 10, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 08:22 AM on July 4, 2009 :
Intercessory prayer has had no demonstrable effects.


According to whom?


Several studies, including those by Larry Dossey who only publicized the statistically insignificant 'benefits'...


It’s usually pretty clear. Blood clotting agents in blood pull together to stop blood flowing out of a wound. We need them all, they work in a specific order. Want to live, don’t want to bleed to death.


You are aware, are you not, that our blood clotting cascade is not universal?

i'd say that an educated person is more likely to become a creationist after going gaga. An uneducated one, at any moment.

You would say that, but you might be wrong of course. I don’t know. You think being a creationist is dumb and gaga so you would think so. That would be intuitive for you.

It is also demonstrable via polling data.  There is a correlation between lack of education and degree of religiosity. For those with educations, there is a correlation between religious conversion/religious upbringing and rejection of evolution.

I’ve said before that DNA has to have 5 levels (statistics, semantics etc) that have to be present to constitute information. DNA has all 5 levels and thus fulfils the criteria for information.
I don't know what you're talking about.
Can you explain the semantics?

Semantics is the information of meaning and implications. It requires determining the meaning, message and implications of the words and sentences. It is not helpful to give a message if it cannot be understood. The communication of information would be stopped without the use of good semantics.

Yes, I am sure you can paraphrase Gitt with the best of them.

I saw Gitt give a talk 3 years ago.  About 1/3 was pure religion - he started with a prayer. Odd for a talk that was advertized as scientific.  The next 1/3 was an attempt to woo the audience with talk of big numbers.  The last was the meat of his talk, and it was simplistic and silly. I asked him if he accepted that innformation can increase at the statistical level.  He said yes.  Then I asked him why, since the 'upper' levels are dependant upon the statistical level, they cannot increase as well.  He had no answer.  It was almost comical - he literally stared at the floor and paced back and forth, and when I started to re-ask the question, he talked over me, basically saying 'It just can't' then he took a question from someone else.

He's selling you a bill of goods.

And it is my bet you don't even know it.

Purpose implies intelligence and a plan.
Yes, of course. But how can you tell? You're not referring to anything factual. Just more abstract concepts.


But we all understand it; it’s really not difficult.

It is post-hoc rationalizations.

The same goes with corn. The domesticated varieties have lots of duplicated genes. And yeah, gene duplication does add things. It adds even more if the duplicated gene mutates.


Adding the same info twice is not like adding information –it’s just repeating information and if the duplicated gene mutates, something is lost, not added.

The undereducated's folk genetics at it again.

If gene duplications do not add information, then the concept of information needs to be reformulated for genomes.

(Edited by derwood 7/13/2009 at 2:05 PM).

(Edited by derwood 7/13/2009 at 2:07 PM).


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 09:13 AM on July 10, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Demon38

Mutation is not generally something good.

No, mutations are mostly neutral, as directly observed.  This is another of your many mistakes involving evolution taht you refuse to correct.


You’re correct that their effect is mostly neutral but that does not make a mutation good in any sense (which is what I said.)It would need to be positive or beneficial in order to bring about positive evolutionary changes as the theory demands. Any mutational change big enough to have a morphological effect would most likely be detrimental.
Mutations are exactly analogous to copying errors during transfer of information. The belief that mutations could slowly change an animal into some other animal is analogous to believing that an old black and white TV could be changed into a color liquid crystal monitor by throwing random parts at it. The impacts will definitely produce change but it’s not going to bring about an improvement.

A mutation in a duplicated strand is as good as having an extra finger coded for, so now you have 6 fingers instead of 5 only the extra finger is a mutated one. The code of the DNA has been altered and is no longer good for a normal finger.


You're changing the subject because you know you can't win.  You originally said:
"Adding the same info twice is not like adding information –it’s just repeating information and if the duplicated gene mutates, something is lost, not added." So nothing is lost because we stil have the original, unmutated swquence.  And we have something new (new information) because the duplicate sequence has mutated, become something different.


No something is lost because the original info coded for something –now it is another of the same, nothing new and it is corrupted. Read carefully what I said and you will find that I said something is lost in the duplicate.

In most cases it ISN'T bad, it's neutral in regards to fitness.  And mutations can and do explain the observed and verified changes in life on earth.


It may not be immediately seen to be bad but it is definitely not a positive change as something has been corrupted. It may be a silent deterioration but eventually those single mutations add up to nothing good. It’s like getting a book with cumulative spelling errors every time it gets copied. It may not change the meaning in any discernable way for a while and you may still pass your exams by studying it but eventually when you have enough copying errors, it won’t make sense anymore.
Mutations can’t and don’t explain the unobserved changes in life credited to the fossils.
And of course we know what happens to bad mutations, natural selection gets rid of them so only the good mutations are left.


No, natural selection gets rid of the bad ones and leaves the neutral ones to build up. There are no ‘good’ ones that have ever been demonstrated.

this has been explained to you over and over, you simply ignore it because you find it inconvient to your magical beliefs.


No actually it hasn’t been explained to me over and over and you’re the one ignoring reality because you find it inconvenient to your magical beliefs. Find me a good mutation please.

Not only didn't it mean to say that but it probably and more likely would change to something like 'I have a cat. I eave a cat" because a random mistake is most unlikely to turn out to have any meaning at all.


Too bad reality disproves your point.  "Probably" and "most unlikey" mean nothing when we see evolution doing just what you say it can't.


What we see is mutation distorting information like copying errors. Any evolutionary changes attributed to mutation are never due to good mutations that increase information –they are only due to loss of something that happens to be fortunate under certain environmental conditions like flightless cormorants or antibiotic resistance.

It happened, it's documented, you're wrong.


That is one interpetation of what can be seen in the here and now. What you fail to understand is that there is more than one interpretation of what can be seen now. Yours is called the evolutionary intepretation, you believe thus you see. It’s the same thing as getting homologous gene sequences in different supposedly related kinds of animals. The cause of this is not necessarily common ancestry. It could also be common designer and since design is obvious in nature, I’ll go with design while you’ll go with the oxymoron, ‘apparent design’.

As long as you don’t have any choices, all you’re ever going to get is confirmation of the only possibility you are prepared to entertain. In that case, it’s not falsifiable and thus not science.
 




-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 02:11 AM on July 11, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Waterboy
Have you noticed how much junk DNA is found within the genome?  Perhaps most new mutations tend to go into the junk pool or become unexpressed recessives.


The theory of junk DNA is a logical possibility if  evolution is true. However, if creation by an intelligence is true then chances are that it isn't junk. If it isn't junk, assuming it is junk is a science stopper.

Fortunately junk DNA is being investigated anyway and from the very small percentage that has been investigated, it appears to have function after all - in other words, it does not appear to be junk. This, of course, is the most logical possibility if intelligent design is the cause of life.

NEAT! Maybe mutation works after all!


Maybe, but it is always good to have more than one possibility for what we observe otherwise we only confirm our prejudices.
You only see evolution as a possibility, I see either evolution or intelligent design as the two theoretical possibilities on the table. The evidence for what mutation is capable of keeps me leaning in the design direction.

I see "I have a cat" as the original designed information required for the organism as a whole. Following on from that, I see "I have a cat. I eave a cat." as an unneeded duplication along with a distortion that is unlikely to give rise to anything meaningful in the designed organism.

You see "I have a cat" as a chance assembly of nucleotide bases that happened to produce an organism. Thus you see "I have a cat. I eave a cat." as something new and exciting to work with.

My analogy of a book with mistakes/mutations in doesn't fly with you because you have no choice but to believe that evolution is the cause of life therefore you have no other possibilites for comparison. Your dogmatic belief in evolution is a drawback and if it is unfalsifiable...


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 02:50 AM on July 11, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

timbrx
And supernaturalism is not an explanation. It's the ultimate lack of an explanation. It's the ultimate "we're completely clueless".
You're half right. To term something as supernatural is to have no known natural explanation.
You're completely wrong. It implies more than that. We don't know what causes the speed of light to be 300.000 km/sec, and we don't deem it supernatural because of that.
Ghosts are natural to other ghosts. Miracles are natural to God.
Your Bible says that there are no ghosts.

Supernaturalism doesn't mean anything. I mean it!
But it may ultimately prove (sorry) to be the crux of everything.
We might find some new paradigm of knowledge and understanding (like what happened with quantum physics). It will provide better explanations and predictions, and we'll never call it "supernaturalism".
Lester
Intercessory prayer has had no demonstrable effects.
According to whom?
According to multiple serious double-blind studies, of course.
And don't ask me to cite them. You know you don't care about them.

They even tried telling some patients in a hospital that people (a congregation) would pray for them.
They had more medical complications. More of them died.
Performance anxiety?
Could their relatives sue the praying congregation?

Because there’s no reality
What?
What you understand when you say "reality" isn't there. It doesn't exist.

So how can you tell? You just look for purpose, and then you know? But how do you know how to find "purpose"?
It’s usually pretty clear.
Is that so? Then would you revise your answer about rabbit warrens? Because you seem confused.

And i can name lots of examples that would confuse you.
From the top of my head: ant galleries, beaver dams, bird nests, spider webs, burrows, and some others that you probably don't know.

It's you who believe in information, purpose, intelligence, and such.
So tell me: do my examples contain any of those?
If you don't know, you have to admit that you don't know what you're talking about.

Since your premise is wrong whatever answer you give (you might as well flip a coin) will be wrong too, and i will refute it easily. But your doubt is most revealing.
You_don't_know_what_you're_talking_about.

Blood clotting agents in blood pull together to stop blood flowing out of a wound. We need them all, they work in a specific order. Want to live, don’t want to bleed to death. There’s purpose.
Oh. That seems clear to you. What about my examples? You like yours, but to demonstrate that you know what you're talking about, test yourself, and answer mine.
Person goes outside to look for something –there’s the purpose, they are looking for something. We all know what purpose is. Lets not let ‘science’ balls up our common sense now.
I really don't know what you're talking about.
Do animals looking for something have purpose too?
If you say they do, then i might have a clue about what you're talking about. If you say they don't, then you lost me again.

You don't even know if rabbit warrens has any.
I think the rabbits live there – so they have purpose? A home? Haven’t given an especial amount of time to musing on the rabbit warren problem.
But you said "It’s usually pretty clear." and "We all know what purpose is. Lets not let ‘science’ balls up our common sense now."
No, Lester. I do not know what you're talking about.
If you do, then show me your "
common sense" and show me how clear it is: Answer_my_examples.

If they need "
an special amount of time" then take back your "pretty clear" and your "We all know".

You can take any rock and say the same thing. You leave it on the ground and it leaves a cameo. So it contained information.
No it has to be a definite message with a purpose and usually a recipient not just something that might or might not be a message depending on how you look at it.
And what does our DNA tell you?
"I, Yahweh, love you enough to clot your blood, but not enough to give you gills so you don't drown, or a better design for your eyes and backbone".

Take EntwickelnCollin's DNA sequence: AGTCCTAGCTACCTGA

Do you see information there?
How lengthy does a DNA strand have to be to contain "information"?

Semantics is the information of meaning and implications.
And what does your DNA mean?

It means "you"? Or what?

It requires determining the meaning, message and implications of the words and sentences.
Oh. And what's the implication of your DNA's words and sentences?
It is not helpful to give a message if it cannot be understood. The communication of information would be stopped without the use of good semantics.
Who's the recipient of the information then? Who was Yahweh talking to?
To us? To himself?

Venom has a purpose and a function. It poisons the recipient not the producer; it is stored specifically to be used in defence or for feeding. It is coded for in the DNA and is produced and held in a portion of the anatomy that can deliver its intended action. I’m sure I’m not alone in this position. How would you like me to check carefully. Like you, I sometimes resort to what I consider to be common sense or intuitive knowledge. If the logic escapes you, tell me why.
Let us ask timbrx what he thinks about this. Ok?

I thank you again for finally giving a straightforward answer.

So Yahweh put weapons in animals to fight animals with weapons, because he know everything would get screwed?
No maybe he knew everything needed to survive and eat and so everything had to be provided with the means to that end.
If he wanted for vegan animals to survive all he had to do was making their predators vegans too. They wouldn't evolve to be carnivores, since Evolution isn't true. Right?
How they use those survival means is entirely up to them much like how we use our brains is up to us.

It’s a choice for us; for them it’s instinct that they are programmed with for their survival.
Wait... Then it's not up to them, right?

Purpose implies intelligence and a plan.
Yes, of course. But how can you tell? You're not referring to anything factual. Just more abstract concepts.
But we all understand it; it’s really not difficult.
Then answer my examples.

I do not know what you're talking about, and my hypothesis is that you don't know either.

Evil?? Are you saying that animals do evil??
No but we might perceive what they do to be evil.
I'm not sure of what you mean. Exclude me from "we".
If a snake bites and kills somebody, it might be considered to be evil but it isn’t if it is a programmed survival instinct in that animal. Only humans have real choice.
Programmed? By whom? Yahweh?
What prevented this "program" to be active in the garden of Eden?
What did the snake eat in the garden of Eden?
Animals lived in harmony, but quite uncomfortable, i bet, having those useless weapons...

Poor aardvark! What would that poor creature eat? What about parasite flatworms?

Had you not said in the past that animals have weapons "because they have to eat"? Now you say "protection"?
Weapons can be protection or for collecting food which is not protection but survival. Every animal has enemies that want to eat it so protection is a good thing. That way it gets a fighting chance.
A chance to fight for Yahweh's amusement, seemingly.

He could have made them all vegans if he wanted.

Sorry. I don't believe in "evil" since i was 11 (maybe 10).
Why because you convinced yourself that there is no reality?
No, because it's a childish concept.
Every being does its best with the information and the tools at hand (or at paw, or at claw).


we are just higher animals with no moral standard and we just do what we do for whatever reason we do it.
I don't know what "higher" means, but we are very moral! It's in our biology. An evolved trait. Who says we're not?
The first quote refers to evolutionary beliefs, not my opinion.
It is a strawman, Lester.
And you're avoiding the question: Who says we're not?
‘Higher’ I would say refers to our ability to think and reason which sets us apart from the ‘other animals’ as evolutionists like to see us.
I've seen several animals reasoning. Not only primates: birds too.

Alex, the parrot, could answer many questions about objects being presented to it.
In a tray full of different objects (of different colors), including blocks (of several colors), the trainer would ask it "How many green blocks?". The parrot would think for a moment, and say "Two".

I saw it being shown two keys (a blue small one and a large green one), and asked "What color bigger?". It would think, and answer "green".

What makes us special is not our ability to think, but our culture. And other animals have that too. We're just better at it.

And how do you know it’s in our biology?
How? My knowledge about Evolution, of course.
Who says it evolved? How can you tell?
If you really care, start a thread and i'll answer.
There are two possibilities –it evolved OR it is built into us by our designer. Even if you don’t like to believe that the designer exists nonetheless you must acknowledge that both possibilities are feasible and should not be prejudicially excluded?
I don't know what you mean by "feasible".

God made everything, and everything went wrong. And you manage to believe that God is perfect. Very weird.
Everything went wrong because we were given choice and most people want to be God of their own lives;
No, Lester. That wasn't it. Either Adam lacked information, or thinking skills, or both (unless you say that he was forced or something, but i know it goes against your beliefs). There are no more options. And Yahweh would be the only responsible for any of those things.

No, it's not like that. Because parents don't decide their offspring's traits. And the good ones don't fill the place with temptations that will doom them.
Neither do they remove them all.
Nice dodge.

It's not the same either. Kids often do know better than their parents. I did. And i hope my kid does too.
My parents know better then me but I didn’t always feel that way.
Isn't your father going to hell according to your beliefs?

He knows better than you, except in the things that really matter, like your eternal soul.
Isn't that right?

That’s the way it should be and I think it’s easier to trust God if you have the experience of trusting your parents.
My trust in God is unmovable.
As for my parents, i trust their good intentions, but not their wisdom or their wits. When they say something, i check with my own brain and see if it makes sense to me. Because (you know?) they're human.
They're human, Lester!
So, again, it's NOT the same. Your analogy doesn't work.
Some people don’t trust anyone but themselves because they’ve never been able to. Life is really messed up these days; it’s upside down and not the way it was designed to be and it’s all a consequence of man ignoring God and doing it his own way.
Things seemed quite worse in the past. Marrying your rapist... First born kids dying... Global floods... Yahweh would even give you hemorrhoids if you disobeyed!

Nowadays you can even insult Yahweh and lead a happy life.

The day your kid decides that you’re a fool and he knows better especially when you are giving him good advice that is for his own protection that you would like him to follow, you will feel pain –only because you love that kid and want what’s best for him. That’s how God must feel when we walk away.
If Yahweh feels pain, then he's not perfect. There's no way around this.

If the creator of everything told me something to my face, i'd listen.
And if Adam was easily tempted, it was because Yahweh wanted it that way.
I don’t think you would listen. Or you might for a while until you got overconfident and decided to go it alone. The Bible doesn’t say how long it took Adam and Eve to get delusions of grandeur. It sounds quick but it might have been 100 years of listening before they decided to go it alone on bad advice from their enemy.
Well, if i had to watch for 100 years an aardvark trying to eat grass, i would get suspicious about my creator's wits... But let's assume a god that makes sense.
I'd listen.

Can anything make itself do you think?
No, i think not. But we're talking about Evolution here, so this is not relevant.
There we go.
No, we don't.
How is it that evolution just breaks all the rules that everything else must follow?
It doesn't.
It's YOUR version of Evolution the one that doesn't make sense and breaks many rules.
The real Evolution (the one that you never understood) doesn't.

But if we agree, then you must see intelligence and purpose in a stone. Do you?
No but I don’t see information in a stone. So I spose I don’t see matter as intelligence only as the product of intelligence.
Huh? Are you not saying the same thing about DNA?

So DNA, unlike the stone, is intelligent. Is that what you just said?

It’s a fallacy that mutations add information,
It's a fallacy that there's information to add to.
they only mess up information or cause loss of information.
Imagine that a mutation suppresses one simple pair of nucleobases.

A loss. Right?

Imagine that another mutation puts it back.

No gain. Right?

Why don't you talk about real chemicals, instead of making bad analogies with books?

For every one 'good' mutation, 99 bad ones occur
Oh, we wish!! Evolution would be much faster then!!
so what does one do with the bad ones while retaining the good one?
They would be selected against?

However, in large populations, new mutations tend to get diluted (the "good" ones too). Even if i have a "good" mutation, half of my children will carry it, 1/4 of my grandchildren, 1/8 of my grand grandchildren (i'm being simplistic, but that's the idea)... That if they don't find each other and copulate among themselves, like the incestuous little brats they are.
In a virtually infinitely large population no new allele would have a chance of success (a new allele would never be present in the same locvs of the chromosomal partner).
I don't know, but i'd bet that blue eyes got spread in a small population.

That's why Evolution tends to work faster with small populations.
And small populations changing quickly would leave much less fossils. Just as we see.
And YET the transitions are very clear. You can see reptiles turning into mammals.


(Edited by wisp 7/15/2009 at 12:35 PM).


-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 03:16 AM on July 11, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

You’re correct that their effect is mostly neutral but that does not make a mutation good in any sense (which is what I said.)It would need to be positive or beneficial in order to bring about positive evolutionary changes as the theory demands. Any mutational change big enough to have a morphological effect would most likely be detrimental.

You don't seem to understand how mutations work in evolution.  A mutation is deemed benefical, neutral or harmful based on the environment it appears in.  A neutral mutation that becomes fixed in a population might become beneficial or harmful if the environment changes.  Why would a mutation that has a morphological effect HAVE to be harmful.  We see how fins on fish turned into legs, this was not harmful to fish living in shallow, swift moving streams.  Can you present any evidence to back up this claim?

Mutations are exactly analogous to copying errors during transfer of information. The belief that mutations could slowly change an animal into some other animal is analogous to believing that an old black and white TV could be changed into a color liquid crystal monitor by throwing random parts at it.

This is inaccurate because a black and white TV doesn't reproduce.  Every mutational change that is beneficial to the organism is most likely retained while harmful mutations are weeded out.  This is not a random process.
Your analogy is fatally flawed.

No something is lost because the original info coded for something –now it is another of the same, nothing new and it is corrupted. Read carefully what I said and you will find that I said something is lost in the duplicate.


I already did read it carefully, it still doesn't make sense.  Nothing is lost because you have the original sequence.  And if the dupl.icate sequence mutates you have the original and the mutated sequence.  Nothing is lost and new information is gained.

It may not be immediately seen to be bad but it is definitely not a positive change as something has been corrupted.

What does corrupted mean?  Show us an example.

It may be a silent deterioration but eventually those single mutations add up to nothing good.

Since we've already seen mutations that add up to something good, your claim is wrong.  Here is how fins evolved in fish, from here:
Fin Evolution

""The emergence of paired appendages was a critical event in the evolution of vertebrates," Cohn said. "The fossil record provides clear evidence that the first fins evolved along the midline. The sequence of evolutionary events leading to the origin of limbs has been known for some time, but only now are we deciphering how these events occurred at a molecular genetic level."

Researchers isolated genes from the spotted catshark, a type of slow-moving shark from the eastern Atlantic Ocean. By studying the activity of a dozen genes in shark embryos, they determined shark median fin development is associated with the presence of genes such as HoxD, Fgf8 and Tbx18, which are vital in the development of human limbs.

They also used molecular markers for different cell types to determine which cells give rise to the median fins, finding that they arise from the same cells that form the vertebrae. These same genes dictate the emergence of symmetrical pairs of fins on the animal sides, showing a shared developmental mechanism in completely different locations, according to Renata Freitas and GuangJun Zhang, co-authors of the paper and graduate students in UF's zoology department."

This directly refutes your claim.  These mutations lead to fins in fish, something definitely "good", no slient deterioration.  How do you expalin this evidence?

Mutations can’t and don’t explain the unobserved changes in life credited to the fossils.

As the evience clearly shows us, yes they do.

No, natural selection gets rid of the bad ones and leaves the neutral ones to build up. There are no ‘good’ ones that have ever been demonstrated.

The appearance fo fins, as shown above, bacteria able to metabolize nylon, Adaptation to High and Low Temperatures by E. coli., Adaptation to Growth in the Dark by Chlamydomonas., Here's a page of beneficial human mutations: HumanMutations ,
There's about 10 beneficial mutations that took me all of 5 minutes to find.  Your claim that we see no beneficial mutations is dead in the water.

No actually it hasn’t been explained to me over and over and you’re the one ignoring reality because you find it inconvenient to your magical beliefs. Find me a good mutation please.

What's the matter, don't know how to do your own research or are you just afraid to?  I just showed you a mess of beneficial mutations, if you had any integrity, you'd admit you were wrong.

What we see is mutation distorting information like copying errors. Any evolutionary changes attributed to mutation are never due to good mutations that increase information –they are only due to loss of something that happens to be fortunate under certain environmental conditions like flightless cormorants or antibiotic resistance.

Ha ha ha, I've already demonstrated you are dead wrong.

That is one interpetation of what can be seen in the here and now. What you fail to understand is that there is more than one interpretation of what can be seen now.

But only one interpretation is fully supported by the evidence, that's evolution.  You have been unable to produce any evidence to support your claims.

Yours is called the evolutionary intepretation, you believe thus you see.

No, it's called the theory of evolution, which explains the fact of evolution.  I don't believe it, I accept it based on the evidence.  

It’s the same thing as getting homologous gene sequences in different supposedly related kinds of animals. The cause of this is not necessarily common ancestry.

Except when homologous gene sequences are compared with the other evidence, like ERVs and comparative anatomy and biogeography and embryology.  The only explaination that works is common ancestry.

It could also be common designer and since design is obvious in nature, I’ll go with design while you’ll go with the oxymoron, ‘apparent design’.

As has been pointed out, a common designer of all the life we see on earth would have to be an idiot of the highest magnitude with all the poor design flaws we see in nature.  

As long as you don’t have any choices, all you’re ever going to get is confirmation of the only possibility you are prepared to entertain. In that case, it’s not falsifiable and thus not science.

And yet, there are many other choices besides evolution.  Unfortunately for you, they have been proven false.  Evolution is no longer falsifiable because we directly observe it, it is a fact.  Evolution is practically applied in manufacturing, medecine, farming, animal husbandry.  It is said we could no longer feed the world population if not for our understanding of evolution.  You're the only one here ignoring reality.

(Edited by Demon38 7/11/2009 at 05:07 AM).

(Edited by Demon38 7/11/2009 at 05:09 AM).
 


Posts: 1664 | Posted: 05:06 AM on July 11, 2009 | IP
waterboy

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Lester

Assuming the 'Intelligent Design' paradigm...
Why allow mutation at all?  Why have different phenotypes at all? Mutation seems to be a very dubious 'strategy' for an intelligently designed biological system where there is NO INTENTION of producing dynamically changing populations. You persistently say that mutations are nearly always neutral or negative. If that is the case where is the intelligence in this 'design'? What is the 'purpose' of all the disadvantageous phenotypes resulting from detrimental mutations?
My best friend was a haemophiliac and he never managed to see any intelligent design in the mutation that robbed him of his factor 8.
Please tell me what is so 'intelligent' about making some people suffer from detrimental mutations. If your God was intelligent and compassionate and good then haemophilia appears to produce a reductio ad absurdum from the TOC premises (at least the Christian ones).

As for junk DNA...  it is certainly worthy of study..  we must assume it has a purpose BUT what do we make of experiments where junk DNA is removed from individuals with no observable affect (positive or negative) on the phenotype of the individual and certainly no detrimental affect on the survivability of the individual. Whatever 'function' it might have these experiments seem to prove that the function is trivial and unnecessary.  So... yes...  some DNA has been classified as junk simply because it appears to have no function and we haven't yet found any purpose for it  BUT some has been demonstrated to be 'unnecessary', strengthening the 'theory' that it has no function.
It does, however, make perfectly good sense within evolutionary theory because evolutionary theory REQUIRES variation upon which  selection can operate. But variation and selection alone will probably only produce what you call micro-evolution. What you call macro-evolution requires an additional 'circumstance', that of geographical isolation.

What is the 'intelligent' purpose of having lots of DNA that can be removed without any significant, and certainly no observable, detrimental affects?






-------
Charis kai Eirene
 


Posts: 218 | Posted: 10:00 AM on July 11, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Demon38
A neutral mutation that becomes fixed in a population might become beneficial or harmful if the environment changes.  


That’s true.

Why would a mutation that has a morphological effect HAVE to be harmful.  


Actually on a rethink it might not be harmful. An example would be wingless beetles on a windy island. They might survive better if they aren’t blown away as the winged ones might be. Natural selection would select for them under windy circumstances –but the point I’m trying to make is more that even though the mutation might be beneficial under those circumstances, it nonetheless involves a loss of information for wings which might be negative under other circumstances.
There is only ever loss of information that can be demonstrated via mutational change, never gain. Of course evolution expects that mutational changes are beneficial a lot of the time but that has never been demonstrated –it is only assumed in keeping with a belief that macro-evolution happens.
This is the difference between what can be demonstrated and what is assumed –observational science vs philosophical naturalistic assumptions.

Every mutational change that is beneficial to the organism is most likely retained while harmful mutations are weeded out.


But harmful mutations are only weeded out if they are big enough to be morphologically disadvantageous or to functionally disadvantage the organism.
The average mutation is a loss of information but is neutral in effect and thus won’t be weeded out. So a mutational load builds up in an organism which is not an advantage just as copy errors in a book render a book less understandable.
There is no evidence to suggest that neutral mutations might be retained and joined by other neutral mutations which might eventually produce an entire new function or organ. That’s a belief system unsupported by the evidence and it doesn’t help to say that the fossils are evidence because all we really know about the fossils is that they died and you can’t prove that any one is related to any other except in a general way as in trilobites are related to other trilobites. You can’t use fossils to prove that one type of organism turned into another because for one we don’t see one species giving birth to another completely different species now, why would we believe it happened in the past except that we want and need to have a naturalistic explanation for life?

We see how fins on fish turned into legs


No we don’t –we imagine that it must have happened based on naturalistic philosophy which says that that must have happened even if we don’t have any evidence.

And if the dupl.icate sequence mutates you have the original and the mutated sequence.  Nothing is lost and new information is gained.


I understand what you’re saying and why you are saying it. However do you understand that you believe what you’re saying only because you assume that all current life on earth came about by a naturalistic process of mutation and natural selection. It is because you believe that,that you just have to believe that a mutated copy of an original strand of DNA is potentially a good thing.
We, on the other hand, take as our starting proposition that life could not have come about by naturalistic means because of the obvious design and the DNA code and various other reasons. For that reason we take the original gene as the perfect code for a particular protein. We take a mutation in a code as a defect in copying of an originally perfect code that was intelligently designed not randomly formed and naturally selected. From our different starting assumptions come different conclusions. We say that life that was once perfect is now corrupted, winding down and heading for extinction while you see it as heading upwards and onwards with man as the pinnacle of evolutionary success insofar as survival is concerned. Our entire worldview is opposite to yours. Our starting assumptions are in opposition. We believe the evidence of genetic deterioration and increased mutational load supports our contention better than it does yours.

Here is how fins evolved in fish


There again, we see that as a story based on a belief system that says that fish must have evolved by natural means from less complex organisms. Meantime our worldview says that fish were created with a lot of genetic potential for survival in different environments, which accounts for the observable micro-evolution of organisms. We also obviously believe that macroevolution is not possible due to inherent limitations. We also see no evidence of macroevolution which supports that contention. We could also say it takes a long time and is therefore unobservable in the present, but we don’t believe that it would happen no matter how long you cared to wait.

This directly refutes your claim.  These mutations lead to fins in fish, something definitely "good", no slient deterioration.  How do you expalin this evidence?


Sorry, that is not evidence in itself, it is an interpretation of the evidence based on a naturalistic belief system/philosophy.

The appearance fo fins


Naturalistic interpretation of the evidence.

bacteria able to metabolize nylon


Inherent micro-adaptation

Adaptation to High and Low Temperatures by E. coli., Adaptation to Growth in the Dark by Chlamydomonas


Microadaptation.

There's about 10 beneficial mutations that took me all of 5 minutes to find.  Your claim that we see no beneficial mutations is dead in the water.


Sorry couldn’t download that no matter how hard I tried. I’d really like to see them but in any case I have no doubt that it’ll be micromutations. If it is a visible mutation it’ll be a loss of something or a copy of something for which the info was already there. There’ll only be old information rearranged never new information for anything macro. As I’ve said before, mutations are only beneficial in certain environments but never involve an increase in genetic information which one requires if a unicellular organism is to become human over billions of years or ever.

What's the matter, don't know how to do your own research or are you just afraid to?  I just showed you a mess of beneficial mutations, if you had any integrity, you'd admit you were wrong.


You’re supposed to be educating me here in the error of my ways but so far, it’s not helping. If I can look it up myself then perhaps you should too, then you don’t need to ask me anything. I don’t think that that is the point though, so your “I’m cleverer than you, look what I found so easily waah waah ” evolutionist type comments are really not appreciated, it just mars an otherwise interesting conversation. As for the integrity thing, it appears that according to evolutionists, having integrity generally means believing them, so if that is the case, I must be lacking it somehow. You sound like Wisp when you say things like that –trying to induce guilt in me via casting doubt on my intentions. Sadly I don’t expect integrity automatically from people that push evolution so I don’t find myself surprised by much.

What we see is mutation distorting information like copying errors. Any evolutionary changes attributed to mutation are never due to good mutations that increase information –they are only due to loss of something that happens to be fortunate under certain environmental conditions like flightless cormorants or antibiotic resistance.


Ha ha ha, I've already demonstrated you are dead wrong.


Did I miss something? Where?

But only one interpretation is fully supported by the evidence, that's evolution.  You have been unable to produce any evidence to support your claims.


This is a very confused ramble. I’ve told you we have the same evidence only we interpret it differently and you still say I am unable to produce any evidence??? And on top of it you say that only one interpretation fully supported by the evidence and you are wrong. First your interpretation is not fully supported by the evidence and secondly our interpretation is much better supported by the evidence in general.

No, it's called the theory of evolution, which explains the fact of evolution.  I don't believe it, I accept it based on the evidence.


No, you accept it without even needing any evidence, you have precisely no alternatives so it just has to be true even when it doesn’t make sense.

The only explaination that works is common ancestry.


Common designer works far better.

As has been pointed out, a common designer of all the life we see on earth would have to be an idiot of the highest magnitude with all the poor design flaws we see in nature.


Well that is a mouthful. Firstly I’m not sure that you could have done better at designing everything so if the common designer is an idiot, I have no words for you. Secondly design flawed by mutation fits in well with the Christian interpretation specifically because we are a cursed world and everything is running down and dying. Far from getting bigger and better, we are heading for extinction and that much is well supported by genetic mutation and the deterioration of the human genome. As for evolution, you should be imagining everything getting bigger and better which is why you think that mutations are bringing about improvements despite the obvious deterioration.

And yet, there are many other choices besides evolution.  Unfortunately for you, they have been proven false.  


Now this is going to be interesting –tell me just one other choice besides evolution and then exactly how this mythical other choice has been proven false.

Evolution is no longer falsifiable because we directly observe it, it is a fact.  


Microvariation is a fact; evolution is a lie. Evolution for the evolutionist is not a choice therefore it has never been falsifiable. It is science fiction.

Evolution is practically applied in manufacturing, medecine, farming, animal husbandry.  


Microevolution or variation within the kind is practically applied, nobody denies that, we can see that, it is evidential and ‘scientific’. It’s the big macro claim that is absolute imagination.

It is said we could no longer feed the world population if not for our understanding of evolution.  


Let us all pray –thank you Evolution our designer and creator for all your wonderful providence! I told you it’s a religion and those pushing it are the holders of the new bible which is equivalent to the Latin that the Roman Catholics wanted to not translate so that the commoners could not understand so that they could stay in charge of all truth. It’s happening again and now the foreign language of the new religion is the language of science. Sadly we are all too stupid to understand it and will thus have to leave the decision-making of the world in the hands of those few atheists and agnostics that do understand. They are the new priests and Darwin is their prophet.

 






-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 09:46 AM on July 12, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Waterboy

Assuming the 'Intelligent Design' paradigm...
Why allow mutation at all?  


It is a curse on humanity. God is no longer sustaining his creation optimally –we were created perfect, we were not supposed to die originally, now we do, our cells mutate, we fall apart in keeping with the 2LOT and we die. Everything else is also winding down, cooling down and dying not just the humans.

Why have different phenotypes at all? Mutation seems to be a very dubious 'strategy' for an intelligently designed biological system where there is NO INTENTION of producing dynamically changing populations.


Micro evolution or microvariation within a kind allows for change and adaptation. We are all created different hence a vast array of possible genetypes. If God made us, why have everyone looking the same. He obviously likes variety.

. If that is the case where is the intelligence in this 'design'? What is the 'purpose' of all the disadvantageous phenotypes resulting from detrimental mutations?


We were created perfect. There was no disease, no suffering, no death. That was how it was supposed to be. However so that we wouldn’t be robots, we were given choice. That’s where the problem came in. None of us are particularly fond of doing what’s right or should I see we all do what’s right in our own eyes – it’s a relative morality thing. God can’t tell us what to do if he has given us choice, he can only advise us on what’s good for us; so now thanks to things like evolution, it’s ‘scientific’, there is no God, there are no standards and man decides the truth. We haven’t changed a bit since Adam’s time. We still don’t want to listen.

My best friend was a haemophiliac and he never managed to see any intelligent design in the mutation that robbed him of his factor 8.
Please tell me what is so 'intelligent' about making some people suffer from detrimental mutations.


Well first off, I’m sorry about your friend. Inherited mutational defects are becoming more and more common along with the genetic load. After the flood the human race were told not to intermarry too closely no doubt precisely for the reason that we need variation and two people carrying a particular mutant gene getting together will likely be a problem. I’m not really sure but didn’t haemophilia start in the Russian Royal family? There would have been inbreeding there as there was in other royal families. I’m not sure if that is how that mutation got stuck in but like the Bible says, the sins of the fathers are passed onto their sons through many generations and I think that applies to people who had no choice but the human race is full of bad choices and that’s why bad things happen. It’s not like God chooses to give anyone a life threatening disease. Neither does it sound like he loves what we do to ourselves via the choices we make. I see the results of close interbreeding in our nearest town. It’s not like the beneficial mutations get together to produce something better, it’s really not a pretty sight what we see arising in small inbreeding towns. Some are plainly  morphologically mutated, others have major biochemical defects in their families such as familial hypercholesteraemia and most if not all are intellectually challenged. I don’t have a lot of faith in mutations I’m afraid and what I observe makes more sense and is in keeping with what I believe to be the truth.
Whenever I feel like making bad choices, I know that there are consequences, not just for me but potentially for everyone I care for into the future. We can’t escape our choices.

what do we make of experiments where junk DNA is removed from individuals with no observable affect (positive or negative) on the phenotype of the individual and certainly no detrimental affect on the survivability of the individual.


I’m not sure but I suspect in keeping with observations on how DNA replication works, there are backup copies and mechanisms for fixing or bypassing errors.

BUT some has been demonstrated to be 'unnecessary', strengthening the 'theory' that it has no function.


I think it unlikely that it is unnecessary but yes you may be able to survive with no obvious problems, it may be backup but more extensive tests need to be done since there is an indication that the junk appears to not be junk after all –what they have studied and that is only a very small percentage of what has been called ‘junk DNA’ does appear to have very complex function such as switching on and off of genes depending on the circumstances or the need at any particular time for a particular protein to be manufactured.

What you call macro-evolution requires an additional 'circumstance', that of geographical isolation.


It would also need some sort of self organizing mechanism since in general mutation only produces noise (in information terms) not potential new information.


 

   




-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 12:59 PM on July 12, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

They might survive better if they aren’t blown away as the winged ones might be. Natural selection would select for them under windy circumstances –but the point I’m trying to make is more that even though the mutation might be beneficial under those circumstances, it nonetheless involves a loss of information for wings which might be negative under other circumstances.

No, the example of the flightless beetles is NOT a loss of information, it's a gain.  the beetles wings are retained.  The wing shields that cover them have become fused.  this is a gain in information.

There is only ever loss of information that can be demonstrated via mutational change, never gain.

Nope, the example of the flightless beetle is a gain in information because the wing coverings are thicker and fused, thicker wings is a gain and the beetle still retains it's wings.

Of course evolution expects that mutational changes are beneficial a lot of the time but that has never been demonstrated

Yes it has (I just demonstated it) but creationists are forced to dismiss it out of hand because it disproves their point and they have no logical answer to it.

This is the difference between what can be demonstrated and what is assumed –observational science vs philosophical naturalistic assumptions.

As I've shown, increased information due to mutation is directly observed.

The average mutation is a loss of information but is neutral in effect and thus won’t be weeded out.

The average mutation is NOT  a loss of information.

So a mutational load builds up in an organism which is not an advantage just as copy errors in a book render a book less understandable.

So what, neutral mutations don't negatively affect the organism.  Genetic code is NOT a book so becoming less "understandable" is meaningless.  Mutations that benefit the organism are kept, neutral mutations may or may not be kept, harmful mutations are weeded out.  Nothing becomes less understandable, the genetic structure still allows the organism to breed and survive, which is all it needs to do to be successful.  A genetic structure picking up more and more mutations does not inherently become weaker or more of a problem.  As demonstrated it can be an advantage.

There is no evidence to suggest that neutral mutations might be retained and joined by other neutral mutations which might eventually produce an entire new function or organ.

Mutations to the Homeotic gene can and do add or radically change body plans.  this too is directly observed.  From here:
Homeotic genes

"Homeotic gene: a gene which defines a region or position in the embryo. Mutations in homeotic genes lead to transformations of one structure into another; the classic example is antennapedia, a mutation that turns the antenna of a fly into a leg."

So Homeotic genes and Homeobox sequences have been directly observed changing body plans.  We can see when and where these genes diverged and compare them we can put together modles of morhological evolution.  This means we directly observe the genes that change body plans and produce new structures and we can see when they mutated and what those mutations caused.  YOur claim is simply wrong.  there is an overwhelming amount of evidence that shows us aquite clearly that mutations to the HOX genes added to and changed body plans.  Direct, observable, testable evidence that comploetely refutes your claims.

That’s a belief system unsupported by the evidence and it doesn’t help to say that the fossils are evidence because all we really know about the fossils is that they died and you can’t prove that any one is related to any other except in a general way as in trilobites are related to other trilobites.

Wrong.  Once again you refuse to touch specific examples because you can't explain them.  the line of reptile to mammal fossils is quite clear and no biologists doubts that mammals evolved from reptiles.  From here:
ReptiletoMammal

"Transition from synapsid reptiles to mammals
This is the best-documented transition between vertebrate classes. So far this series is known only as a series of genera or families; the transitions from species to species are not known. But the family sequence is quite complete. Each group is clearly related to both the group that came before, and the group that came after, and yet the sequence is so long that the fossils at the end are astoundingly different from those at the beginning. As Rowe recently said about this transition (in Szalay et al., 1993), "When sampling artifact is removed and all available character data analyzed [with computer phylogeny programs that do not assume anything about evolution], a highly corroborated, stable phylogeny remains, which is largely consistent with the temporal distributions of taxa recorded in the fossil record." Similarly, Gingerich has stated (1977) "While living mammals are well separated from other groups of animals today, the fossil record clearly shows their origin from a reptilian stock and permits one to trace the origin and radiation of mammals in considerable detail." "

So once again you are wrong, we can learn a lot from fossils, much more than your juvenile claim, : "all we really know about the fossils is that they died".  Who made you an expert, how many fossils have you directly examined?  How much comparative anatomy do you know?  
From here:
ReptiletoMammal 2

"The transition from reptile to mammal has an excellent record. The following fossils are just a sampling. In particular, these fossils document the transition of one type of jaw joint into another. Reptiles have one bone in the middle ear and several bones in the lower jaw. Mammals have three bones in the middle ear and only one bone in the lower jaw. These species show transitional jaw-ear arrangements (Hunt 1997; White 2002b). The sequence shows transitional stages in other features, too, such as skull, vertebrae, ribs, and toes.


Sphenacodon (late Pennsylvanian to early Permian, about 270 million years ago (Mya)). Lower jaw is made of multiple bones; the jaw hinge is fully reptilian. No eardrum.
Biarmosuchia (late Permian). One of the earliest therapsids. Jaw hinge is more mammalian. Upper jaw is fixed. Hindlimbs are more upright.
Procynosuchus (latest Permian). A primitive cynodont, a group of mammal-like therapsids. Most of the lower jaw bones are grouped in a small complex near the jaw hinge.
Thrinaxodon (early Triassic). A more advanced cynodont. An eardrum has developed in the lower jaw, allowing it to hear airborne sound. Its quadrate and articular jaw bones could vibrate freely, allowing them to function for sound transmission while still functioning as jaw bones. All four legs are fully upright.
Probainognathus (mid-Triassic, about 235 Mya). It has two jaw joints: mammalian and reptilian (White 2002a).
Diarthrognathus (early Jurassic, 209 Mya). An advanced cynodont. It still has a double jaw joint, but the reptilian joint functions almost entirely for hearing.
Morganucodon (early Jurassic, about 220 Mya). It still has a remnant of the reptilian jaw joint (Kermack et al. 1981).
Hadrocodium (early Jurassic). Its middle ear bones have moved from the jaw to the cranium (Luo et al. 2001; White 2002b). "

We see that there is a great deal more information we can learn from fossils than "they died".    How do you explain this evidence without evolution.  

You can’t use fossils to prove that one type of organism turned into another because for one we don’t see one species giving birth to another completely different species now, why would we believe it happened in the past except that we want and need to have a naturalistic explanation for life?

Yes we can use fossil evidence to show evolution, as the beautiful reptile to mammal line shows.  It is so complete that no biologist doubts that mammals evolved from reptiles, bsoed on the evidence.  It is considered a fact because the evidence is so great.  And of course we see one species giving birth to another species today, both in the wild and in the lab.  You can deny it all you want, you're still wrong.  

No we don’t –we imagine that it must have happened based on naturalistic philosophy which says that that must have happened even if we don’t have any evidence.

Nope, no philosophy involved, just cold, hard objective evidence.  From my above post:

Researchers isolated genes from the spotted catshark, a type of slow-moving shark from the eastern Atlantic Ocean. By studying the activity of a dozen genes in shark embryos, they determined shark median fin development is associated with the presence of genes such as HoxD, Fgf8 and Tbx18, which are vital in the development of human limbs.

They also used molecular markers for different cell types to determine which cells give rise to the median fins, finding that they arise from the same cells that form the vertebrae. These same genes dictate the emergence of symmetrical pairs of fins on the animal sides, showing a shared developmental mechanism in completely different locations, according to Renata Freitas and GuangJun Zhang, co-authors of the paper and graduate students in UF's zoology department."

Refute the evidence or go home.  Lester your debate style is like a Monty Python argument clinic.  I present evidence to back up all my claims, provide specific examples and since you can't counter it, all you do is say "No it isn't".  You're not fooling anyone.  Refute the evidence that  "shark median fin development is associated with the presence of genes such as HoxD, Fgf8 and Tbx18", which shows us how and when fins evolved (new information, new body parts) or go home.

understand what you’re saying and why you are saying it. However do you understand that you believe what you’re saying only because you assume that all current life on earth came about by a naturalistic process of mutation and natural selection.

Wrong, i don't believe that at all.  I make no assumptions.  I accept it based on the evidence.  Evidence that you claim doesn't exist but when it's shown to you all you can do ist illogically deny it.

It is because you believe that,that you just have to believe that a mutated copy of an original strand of DNA is potentially a good thing.

Nope, these are conclusions drawn from the evidence.  YOu don't seem to understand how science works, do you.

We, on the other hand, take as our starting proposition that life could not have come about by naturalistic means because of the obvious design and the DNA code and various other reasons.

Which you can't support at all.  Your only evidence is that you believe in magic.

There again, we see that as a story based on a belief system that says that fish must have evolved by natural means from less complex organisms.

No, it's a conclusion drawn from the evidence.

Sorry, that is not evidence in itself, it is an interpretation of the evidence based on a naturalistic belief system/philosophy.

Sorry, it is evidence.  We directly observe what mutations caused the fins to form and when those mutations occurred.  No philosophy involved.

Inherent micro-adaptation

Mutation and natural selection and increase in information, classic evolution.

You’re supposed to be educating me here in the error of my ways but so far, it’s not helping.

Your close mindedness and superstitious beliefs preclude you from ever becoming educated about biology, you remain willfully ignorant.

Did I miss something?

Yes all the examples of beneficial mutations, changing body plans due to mutation, addition of new body parts due to mutation.  You ignored everything.

This is a very confused ramble. I’ve told you we have the same evidence only we interpret it differently and you still say I am unable to produce any evidence???

Yes, you have been unable to produce any evidence to support your claims.  You handwave specific examples with nothing more than "NO it isn't", you try to use convoluted illogical arguments to counter plainly observed facts.  You seem to be having trouble understanding what I'm saying, ,let me clear it up for you....  You have produced no evidence to support your claims and you have been unable to refute any of my claims.

No, you accept it without even needing any evidence, you have precisely no alternatives so it just has to be true even when it doesn’t make sense.

No I accept it based on the evidence.  there are no longer any alternatives because they have been sisproven, that's how science works.

Common designer works far better.

Your unsupported claim that has been destroyed at every turn.

Well that is a mouthful. Firstly I’m not sure that you could have done better at designing everything so if the common designer is an idiot, I have no words for you.

So many examples of design flaws that your common designer would have to be an idiot, not the all knowing super being you claim.  

Secondly design flawed by mutation fits in well with the Christian interpretation specifically because we are a cursed world and everything is running down and dying.

Yes but this claim falls apart when you look at the evidence.  As has been pointed out, humans walk upright.  Because we evolved from a quadruped that walked on all fours our spine is ill suited to walking upright.  this is evidenced by all the back related problems we suffer.  Our spine is not suited to walking up right!  Evolution explains this nicely.  But your saying that everything was perfect in the garden of Eden.  If it was, Adam and Eve could not have been upright walking humans, the human spine is inherently flawed for upright walking...It's contradictions like this that fully invalidate your superstitious claims.

Far from getting bigger and better, we are heading for extinction and that much is well supported by genetic mutation and the deterioration of the human genome.

Oh yes, the signs are all there, humanity is heading for extincition because our population keeps getting bigger and bigger...????  It's ridiculous statements like this that demonstrate just how wrong you are.

Now this is going to be interesting –tell me just one other choice besides evolution and then exactly how this mythical other choice has been proven false.

Lamarkism

"Lamarckism (or Lamarckian evolution) is the once popularly accepted, but since discredited, idea that an organism can pass on characteristics that it acquired during its lifetime to its offspring (also known as heritability of acquired characteristics or soft inheritance). It is named for the French biologist Jean-Baptiste Lamarck (1744–1829), who incorporated the action of soft inheritance into his evolutionary theories and is often incorrectly cited as the founder of soft inheritance. It proposed that individual efforts during the lifetime of the organisms were the main mechanism driving species to adaptation, as they supposedly would acquire adaptive changes and pass them on to offspring.
After publication of Charles Darwin's theory of natural selection, the importance of individual efforts in the generation of adaptation was considerably diminished. Later, Mendelian genetics supplanted the notion of inheritance of acquired traits, eventually leading to the development of the modern evolutionary synthesis, and the general abandonment of the Lamarckian theory of evolution in biology. In a wider context, soft inheritance is of use when examining the evolution of cultures and ideas, and is related to the theory of
Memetics."

Ask and you shall receive.  Is one enough or do you want more?

Microvariation is a fact; evolution is a lie. Evolution for the evolutionist is not a choice therefore it has never been falsifiable. It is science fiction.

Evolution is a fact, macroevolution is a fact, common ancestry it a fact.

Let us all pray –thank you Evolution our designer and creator for all your wonderful providence!

Stop trying to drag evolution down to your level!  It;'s a scientific theory, not a religion.  it's an incredibly useful scientific theory.  We have no one to thank but the scientists who've developed it.  
 


Posts: 1664 | Posted: 7:18 PM on July 12, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:46 AM on July 12, 2009 :

There is only ever loss of information that can be demonstrated via mutational change, never gain.


Only with your personal definition of information.

Of course evolution expects that mutational changes are beneficial a lot of the time


No, it doesn't.  Did you check the source for that claim?

but that has never been demonstrated –it is only assumed in keeping with a belief that macro-evolution happens.
This is the difference between what can be demonstrated and what is assumed –observational science vs philosophical naturalistic assumptions.


Your complaints about philosophic naturalism are demonstrated false by the significant numbers of Christian scientists, Francis Collins for example.

Francis Collins in that liberal rag -- The National Review

Or the American Scientific Affiliation
The American Scientific Affiliation  (ASA) is a fellowship of men and women in science and disciplines that relate to science who share a common fidelity to the Word of God and a commitment to integrity in the practice of science. In matters of science and Christian faith, we offer Christian scholarship, education, fellowship and service to ASA members, churches, educational institutions, the scientific community, and society.



-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 9:52 PM on July 12, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Delete extra tags to fix the html.

(Edited by Apoapsis 7/13/2009 at 2:37 PM).


-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 9:57 PM on July 12, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:46 AM on July 12, 2009 :
We, on the other hand, take as our starting proposition that life could not have come about by naturalistic means because of the obvious design and the DNA code and various other reasons. For that reason we take the original gene as the perfect code for a particular protein. We take a mutation in a code as a defect in copying of an originally perfect code that was intelligently designed not randomly formed and naturally selected. From our different starting assumptions come different conclusions. We say that life that was once perfect is now corrupted, winding down and heading for extinction while you see it as heading upwards and onwards with man as the pinnacle of evolutionary success insofar as survival is concerned. Our entire worldview is opposite to yours.



Were the first spiders created with perfect venom?


(Edited by Apoapsis 7/12/2009 at 10:37 PM).


-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 10:35 PM on July 12, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I started a specific thread. I think this issue is worth it.


-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 10:42 AM on July 13, 2009 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from wisp at 03:16 AM on July 11, 2009 :
timbrx
And supernaturalism is not an explanation. It's the ultimate lack of an explanation. It's the ultimate "we're completely clueless".
You're half right. To term something as supernatural is to have no known natural explanation.
You're completely wrong. It implies more than that. We don't know what causes the speed of light to be 300.000 km/sec, and we don't deem it supernatural because of that.


Amazing...

So, if we have no current explanation for the lightening-associated phenomenon known as 'sprites' that they must therefore be supernatural in nature?

What a completley absurd, ridiculous, simple-minded position for an adult to have.


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1646 | Posted: 2:10 PM on July 13, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 09:46 AM on July 12, 2009 :
Let us all pray –thank you Evolution our designer and creator for all your wonderful providence! I told you it’s a religion and those pushing it are the holders of the new bible which is equivalent to the Latin that the Roman Catholics wanted to not translate so that the commoners could not understand so that they could stay in charge of all truth.
 

That sounds rather bitter.  You live in a time with the greatest access to information in history, with thousands and thousands of scientific papers at your fingertips.

Lanl arXiv for Physics


PubMed Central for biology

It’s happening again and now the foreign language of the new religion is the language of science. Sadly we are all too stupid to understand it and will thus have to leave the decision-making of the world in the hands of those few atheists and agnostics that do understand. They are the new priests and Darwin is their prophet.


It is a choice to remain scientifically illiterate.

Fortunately many Christian scientists have not made that choice.
American Scientific Affiliation



       The ASA does not take a position on issues when there is honest disagreement among Christians provided there is adherence to our statement of faith and to integrity in science.  Accordingly, the ASA neither endorses nor opposes young-earth creationism which recognizes the possibility of a recent creation with appearance of age or which acknowledges the unresolved discrepancy between scientific data and a young-earth position.  However, claims that scientific data affirm a young earth do not meet the criterion of integrity in science.  Any portrayal of the RATE project as confirming scientific support for a young earth, contradicts the RATE project’s own admission of unresolved problems.  The ASA can and does oppose such deception.



A common issue for Christians is in fields where the scientific results appear to conflict with common ideas or deductions from the Bible. It is not unusual in those cases to find skepticism about the science itself. Being a skeptic in science isn't a matter of just saying "I don't believe it" or citing technobabble that dazzles the non-expert into thinking there is serious scientific debate. Legitimate  skepticism needs to go through scientific methodology as well. It needs to be published in peer-reviewed technical literature, corroborated by independent laboratories and accepted or addressed by the relevant technical community. It's a tall order but until those hurdles are cleared, the skepticism is merely a proposed idea.
Integrity in Science

(Edited by Apoapsis 7/13/2009 at 10:22 PM).


-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 10:08 PM on July 13, 2009 | IP
orion

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester -
It’s happening again and now the foreign language of the new religion is the language of science. Sadly we are all too stupid to understand it and will thus have to leave the decision-making of the world in the hands of those few atheists and agnostics that do understand. They are the new priests and Darwin is their prophet.



Hey Lester, how about professor Francisco Ayala of UC Irvine.  He's an evolutionary biologist and geneticist.

He's also an ordained Dominican priest.  

From here - Francisco Ayala

Q: Why are organizations worldwide observing Darwin's 200th birthday?

A: Darwin is one of the greatest scientists of all time. He made what may be the most important discovery ever: natural selection, which explains the evolution of organisms, diversity and adaptation. It explains why we have eyes to see and hands to grasp, why birds have wings to fly and fish have gills to breathe in water. The world wants to recognize such a significant discovery. Today, we know 100 times more about evolution than Darwin knew, but he's responsible for the most important 1 percent — the theory of natural selection.

Q: Can belief in evolution and God coexist?

A: Yes. A more precise way of putting it is that belief in God can coexist with scientific knowledge of evolution. We don't have belief in evolution; belief is accepting something for which we have no evidence. We have strong scientific evidence of evolution. So it's possible to accept evolution and have faith in God because science has nothing to say about that — you can't prove or disprove the existence of God. Science also can stimulate one to become religious, especially those who study and appreciate the beauty of nature.

Q: What interests you about the evolution/creationism debate?

A: I like to look for opportunities to educate people on both subjects. Evolution and religious faith definitely are compatible, but not when people leave their own territory — for example, if a religious person claims the Bible makes a scientific statement or a scientist says science proves God doesn't exist. The Bible was not written to be a book on biology, astronomy or physics. It's a book about religion, our relationship with God, and our relationships with each other. When a scientist says science disproves God's existence, it's a serious misstatement. Science has nothing to say about God.


A very interesting person, in my opinion.  I like him.

(Edited by orion 7/14/2009 at 12:28 AM).

(Edited by orion 7/14/2009 at 12:32 AM).
 


Posts: 1460 | Posted: 12:20 AM on July 14, 2009 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester10
Demon38
A neutral mutation that becomes fixed in a population might become beneficial or harmful if the environment changes.
That’s true.
Why would a mutation that has a morphological effect HAVE to be harmful.
Actually on a rethink it might not be harmful. An example would be wingless beetles on a windy island. They might survive better if they aren’t blown away as the winged ones might be. Natural selection would select for them under windy circumstances –but the point I’m trying to make is more that even though the mutation might be beneficial under those circumstances, it nonetheless involves a loss of information for wings which might be negative under other circumstances.
First of all congrats on your rethought.

Now, you chose an example of "loss". Information got screwed, producing a functional loss. Right?
Well, why can't that happen with the extra fingers too? Why couldn't they be naturally selected for?

Wanna call it a "loss"? Fine. Call it what you will, but that's the way Evolution has always worked.

If something new appears you'll deem it "random mutational noise" or something like that.

Fine! Call it that, and stop saying it doesn't happen!
Because this should not be a semantic issue. And you make it semantic when you talk about abstract concepts like "information", "purpose" and stuff.

bacteria able to metabolize nylon
Inherent micro-adaptation

Adaptation to High and Low Temperatures by E. coli., Adaptation to Growth in the Dark by Chlamydomonas
Microadaptation.
Name calling. Evidence ignoring.

Wanna call it that? Fine! But you won't deny Evolution just by tagging.

Demon38
Every mutational change that is beneficial to the organism is most likely retained
I think it depends. In a large population that doesn't have to happen. A beneficial mutational change will (most likely, i think) get diluted.
Large populations are much better at weeding things out than at gaining new things. At least to my understanding.
Extrapolating from what creationists in this forum say, if a mutation takes something away, and puts it back, there's an overall loss.
Isn't it weird?

Derwood, can a mutation remove or add a single pair of nucleobases?



-------
Quote from Lester10 at 2:51 PM on September 21, 2010 in the thread
Scientists assert (by Lester):

Ha Ha. (...) I've told you people endlessly about my evidence but you don't want to show me yours - you just assert.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 3037 | Posted: 5:30 PM on July 14, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Demon38

No, the example of the flightless beetles is NOT a loss of information, it's a gain.  the beetles wings are retained.  The wing shields that cover them have become fused.  this is a gain in information.


Well I don’t know, I think you gave the reality of the situation away without realizing it. The wings were already there, the shields were already there but the shields didn’t separate the way they were supposed to. I’ll bet this is an example of defective mutated information –see if you can find out how it actually works on a developmental level and I will too.

thicker wings is a gain


No, I doubt it somehow. Let’s find out.

Of course evolution expects that mutational changes are beneficial a lot of the time but that has never been demonstrated


Yes it has (I just demonstated it) but creationists are forced to dismiss it out of hand because it disproves their point and they have no logical answer to it.


I’m sensing some projection here.

increased information due to mutation is directly observed.


Never has been observed before and I’m betting it never does.

The average mutation is NOT  a loss of information.


It always is.

So what, neutral mutations don't negatively affect the organism.  Genetic code is NOT a book so becoming less "understandable" is meaningless.  


They may not cause an effect in the short term, they may lie dormant but as the distorted information builds up, problems develop in the organism.Genetic information is virtually analogous to the software in a computer programme.Genetic information (DNA) and a computer programme have information content which permits the cell or the computer to do something –to purposefully carry out a task. To imagine that random copying errors in a computer programme will eventually result in a more useful programme is pretty unreasonable. As Roddy Bullock points out in his book “The Cave Painting –a Parable of Science”  -‘ To think that some rudimentary genetic material, gradually over time, reproduced itself with innumerable chance random errors to produce the information rich DNA of humans goes beyond scientific reasoning and reaches deep in to speculative wish projection.’

A genetic structure picking up more and more mutations does not inherently become weaker or more of a problem.  As demonstrated it can be an advantage.


The only mutations that can be considered to be beneficial that have ever been demonstrated are biochemical mutations such as those that cause antibiotic resistance and sickle cell anaemia and those mutations are only advantageous in certain limited situations. What evolution needs are beneficial mutations that affect morphology otherwise they cannot affect morphological evolution. Mutations are almost universally harmful.( I take back agreeing that they are usually neutral – they aren’t the more I think about what I have read from genetics.) In human beings they are classified as birth defects and often result in death or sterility. Humans today suffer from more than 4000 birth defects caused by mutations –but what benefits can we list from mutation? Anybody got one to offer???

Mutations in homeotic genes lead to transformations of one structure into another; the classic example is antennapedia, a mutation that turns the antenna of a fly into a leg."


An antenna into a leg? A functional real leg? On it’s head I presume? Doing what? Does it have toes? Does it allow the fly to  walk upside down? Is this your example of a beneficial morphological mutation?

there is an overwhelming amount of evidence that shows us aquite clearly that mutations to the HOX genes added to and changed body plans.


Except that hox genes only kick in after body plans are laid out….as for the use of the word ‘overwhelming’ I have heard that adjective used in conjunction with fossil evidencefor evolution in the past and it turned out to be underwhelming.

Once again you refuse to touch specific examples because you can't explain them.  the line of reptile to mammal fossils is quite clear


I’ve seen that line before and what you don’t appear to understand is that this line theoretically happened in the past. Now all we have is buried bones and no mechanism to demonstrate that it is even vaguely possible for a reptile to turn into a mammal. Remember that computer programme. Also remember I’ll be waiting for your positive morphological mutation example so that we can know that it is possible. I can also line up a whole bunch of knives and claim that one changed into the other but if I have no mechanism then you’re not going to swallow that whole. Lining up bones from fossils does not make them related.
The horse series for example is an example of a whole bunch of horses lined up according to size with a rock badger stuck at the beginning just for variety. We have horses of different sizes and kinds today but it doesn’t mean that one evolved into another via mutational changes

and no biologists doubts that mammals evolved from reptiles.  


Not the ones that have chosen to believe in natural processes as the explanation for all of life, no, but there are biologists that don’t believe it and I do believe that the numbers are increasing all the time.

How much comparative anatomy do you know?


Comparative anatomy doesn’t help you if there is no mechanism to change one organism into another. And computer simulations that show how these things happened are a joke based on a belief system that insists on demonstrating things believed to be historical from dead bones that don’t talk but need to be interpreted according to a worldview. Your programmer had presuppositions remember, he was not a blank slate.

Yes we can use fossil evidence to show evolution, as the beautiful reptile to mammal line shows.  It is so complete that no biologist doubts that mammals evolved from reptiles, bsoed on the evidence.  It is considered a fact because the evidence is so great.


I hear this sort of hype so often, it just has no substance. How does one change into the other? Demonstrate how these mutations can do it so that we can know that it is at least possible? Mutations are mistakes, mistakes don’t make improvements and natural selection only selects, it cannot make something new and coordinated and functional where there is no plan. You know it instinctively but you are in a mental warp –like the matrix.

And of course we see one species giving birth to another species today, both in the wild and in the lab.  


Oh you mean like fruit flies giving rise to mutant fruit flies that they can’t mate with? You know they are both fruit flies though, instinctively, don’t you? Nothing new has been created but that which was, is now badly mutated and that is not a good thing. Antibiotic resistant bacteria may have advantages in certain environments but there is a fitness cost, they are weaker than the originals in other ways.

Nope, no philosophy involved, just cold, hard objective evidence


If you didn’t start with a presumption of naturalism, I wouldn’t call it a philosophy, but as I have mentioned before, naturalism is the starting point so it just has to be the explanation for what we see, whether it is or not. That’s philosophical,not evidence-based reasoning.

that  "shark median fin development is associated with the presence of genes such as HoxD, Fgf8 and Tbx18", which shows us how and when fins evolved (new information, new body parts) or go home.


That’s interpretation of data –not evidence. Nobody was there and no-one can know that that is what happened. If a train is heading from Sydney to Perth then there’s a chance that it just might get there theoretically but your train is headed in the wrong direction –it always shows loss, not gain. All your interpretations are based on theoretical gain from mutations, increase in complexity and order from random mutation. Show me that it can be demonstrated and it might start to make sense.

YOu don't seem to understand how science works, do you.


In the case of evolution, it presupposes things and then believes it. Evolutionists don’t appear to understand how evolution differs fundamentally from real observational science.

We, on the other hand, take as our starting proposition that life could not have come about by naturalistic means because of the obvious design and the DNA code
Which you can’t support at all.


We can see it –all the parts work together. You can see it too –only you won’t acknowledge it as real design, you have to pretend it is just apparent design.

Sorry, it is evidence.  We directly observe what mutations caused the fins to form and when those mutations occurred.  


No you don’t –you interpret the evidence and that’s what you imagine happened. Note, you don’t directly observe the fins forming, you directly observe what you believe are the mutations which you believe led to the formation of fins.That’s quite a different thing. Do you really think that that is enough observation? Do you think that that amounts to real observation and real observational science?

Your close mindedness and superstitious beliefs preclude you from ever becoming educated about biology, you remain willfully ignorant.


Mutations are almost universally demonstrably harmful so I don’t believe that one animal evolved into another more complex form. You believe but can’t demonstrate that mutations lead to new and improved features - but I am superstitious and closed minded –that’s interesting. I hate to be the one to break the news but it’s your beliefs that are magical, not mine.

there are no longer any alternatives because they have been sisproven, that's how science works.


The problem is not that there are no longer any alternatives, the problem is that there never was any alternative.

So many examples of design flaws that your common designer would have to be an idiot, not the all knowing super being you claim.


We can build a factory that produces a product but not even our brightest minds can produce a factory that produces another factory that produces something. I think that this designer of life is hardly an idiot –in fact I think that only fools could point to the perceived flaws and miss the big picture the way evoluionists do.You are all so blind!

As has been pointed out, humans walk upright.  Because we evolved from a quadruped that walked on all fours our spine is ill suited to walking upright.


OR we were created to walk upright and quite separate from the animals. The evidence doesn’t confirm for you what you believe, you interpret it that way, in fact you insist that that is the only possibility. So mutation causes negative effects mostly but humans evolved from quadrapeds. The evidence doesn’t matter to you, that is why I call it philosophy.

this is evidenced by all the back related problems we suffer.  Our spine is not suited to walking up right!  Evolution explains this nicely.


It may be a nice explanation but I don’t believe it is true –based on the evidence! It’s just a story that you believe. The people with back problems don’t stand up properly, they slouch, how about that explanation? Lots of people don’t suffer from back problems –how do we explain that?

If it was, Adam and Eve could not have been upright walking humans, the human spine is inherently flawed for upright walking...


Garbage! We walk upright perfectly-where are you seeing all these people with back problems? Do you work in a back clinic? Are you sure you’re looking at all the evidence and not just that that makes us look like evolved apes? You’re lost in space –you need to come home now.

It's contradictions like this that fully invalidate your superstitious claims.


Oh my goodness. In your dreams.

Oh yes, the signs are all there, humanity is heading for extincition because our population keeps getting bigger and bigger...????  It's ridiculous statements like this that demonstrate just how wrong you are.


Hellooo! There may be more of us but we’re not getting better. Mutational load, thousands of mutational syndromes building up in the human population, wake up ! Just who’s being ridiculous here?!

Ask and you shall receive.  Is one enough or do you want more?


Lamarkism has been discredited a very long time ago. I’m talking about choices we have now. It still all boils down to ‘created or evolved’ (by whatever mechanism) –those are our two choices.

 




-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 08:30 AM on July 15, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 08:30 AM on July 15, 2009 :
increased information due to mutation is directly observed.


Never has been observed before and I’m betting it never does.


You lost the bet.


   Contribution of individual random mutations to genotype-by-environment interactions in Escherichia coli
   Susanna K. Remold* and Richard E. Lenski

   Center for Microbial Ecology, Michigan State University, East Lansing, MI 48824

   Edited by M. T. Clegg, University of California, Riverside, CA, and approved July 30, 2001 (received for review March 22, 2001)

   Numerous studies have shown genotype-by-environment (G×E) interactions for traits related to organismal fitness. However, the genetic architecture of the interaction is usually unknown because these studies used genotypes that differ from one another by many unknown mutations. These mutations were also present as standing variation in populations and hence had been subject to prior selection. Based on such studies, it is therefore impossible to say what fraction of new, random mutations contributes to G×E interactions. In this study, we measured the fitness in four environments of 26 genotypes of Escherichia coli, each containing a single random insertion mutation. Fitness was measured relative to their common progenitor, which had evolved on glucose at 37°C for the preceding 10,000 generations. The four assay environments differed in limiting resource and temperature (glucose, 28°C; maltose, 28°C; glucose, 37°C; and maltose, 37°C). A highly significant interaction between mutation and resource was found. In contrast, there was no interaction involving temperature. The resource interaction reflected much higher among mutation variation for fitness in maltose than in glucose. At least 11 mutations (42%) contributed to this G×E interaction through their differential fitness effects across resources. Beneficial mutations are generally thought to be rare but, surprisingly, at least three mutations (12%) significantly improved fitness in maltose, a resource novel to the progenitor. More generally, our findings demonstrate that G×E interactions can be quite common, even for genotypes that differ by only one mutation and in environments differing by only a single factor.


How could an insertion mutation not be an example of increased information?


-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 12:37 PM on July 15, 2009 | IP
Fencer27

|      |       Report Post




Junkie
Post Score
Adjustment:
n/a

Rate this post:

Lester,

Comparative anatomy doesn’t help you if there is no mechanism to change one organism into another.


Mutation plus natural selection.

What counts as information?






-------
"So in everything, do to others what you would have them do to you, for this sums up the Law and the Prophets." - Jesus (Matthew 7:12)
 


Posts: 551 | Posted: 01:00 AM on July 16, 2009 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Well I don’t know, I think you gave the reality of the situation away without realizing it. The wings were already there, the shields were already there but the shields didn’t separate the way they were supposed to. I’ll bet this is an example of defective mutated information –see if you can find out how it actually works on a developmental level and I will too.

It's a beneficial mutation for the beetle, nothing is lost, it allows the beetle to survive in it's environment.  How do you define "mutaional defect"?

I’m sensing some projection here.

No, beneficial mutations have been observed, taht is a fact.

Never has been observed before and I’m betting it never does.

Yes it has, see Apoapsis for a quick example.

Youi claim all mutaitions are a loss of imnformation, you've been shown numerous mutations that are a gain in information, back up your claim with evidence or retract it.  From here:
InfoIncrease
"Most biologists would see this as a gain in information: a change in environment (the availability of cow's milk as food) is reflected by a genetic mutation that lets people exploit that change (gaining the ability to digest milk as an adult). Creationists, however, dismiss this as a malfunction, as the loss of the ability to switch off the production of the milk-digesting enzyme after childhood.
Rather than get bogged down trying to define what information is, let's just look at a few other discoveries made by biologists in recent years. For instance, it has been shown a simple change in gene activity in sea squirts can turn their one-chambered heart into a working two-chambered one. Surely this counts as increasing information?"

Is a change from a one chambered heart to a two chambered heart an increase in information?

They may not cause an effect in the short term, they may lie dormant but as the distorted information builds up, problems develop in the organism.

I say this is BS, show us evidence of this.

Genetic information is virtually analogous to the software in a computer programme.Genetic information (DNA) and a computer programme have information content which permits the cell or the computer to do something –to purposefully carry out a task.

DNA is NOT analogous to software, it is just chemicals reacting.  there is no language involved, no symbolic code, no intelligent intent.

What evolution needs are beneficial mutations that affect morphology otherwise they cannot affect morphological evolution.

And when you have been shown how these mutations work and evidence for them occurring, you igmnore them and run away.  When I posted this you had nothing to refute it: FinEvolution

"Researchers isolated genes from the spotted catshark, a type of slow-moving shark from the eastern Atlantic Ocean. By studying the activity of a dozen genes in shark embryos, they determined shark median fin development is associated with the presence of genes such as HoxD, Fgf8 and Tbx18, which are vital in the development of human limbs.

They also used molecular markers for different cell types to determine which cells give rise to the median fins, finding that they arise from the same cells that form the vertebrae. These same genes dictate the emergence of symmetrical pairs of fins on the animal sides, showing a shared developmental mechanism in completely different locations, according to Renata Freitas and GuangJun Zhang, co-authors of the paper and graduate students in UF's zoology department."

Here we see biologists identifying the genes that lead to fin developement.  These are mutations that caused a change in morphology, these are mutations that increase information, these are mutations that were extremely beneficial.

Mutations are almost universally harmful.( I take back agreeing that they are usually neutral – they aren’t the more I think about what I have read from genetics.)

Support your statement with evidence.  All the experts say you are wrong, why do yo uclaim you are right?

In human beings they are classified as birth defects and often result in death or sterility. Humans today suffer from more than 4000 birth defects caused by mutations –but what benefits can we list from mutation? Anybody got one to offer???

And yet the average human has a 100 or so neutral mutations in their genetic makup and the average human lives to over 60 yars old.
Beneficial human mutations?  Here ya go:
Beneficial Human Mutations

"Genetic variant showing a positive interaction with beta-blocking agents with a beneficial influence on lipoprotein lipase activity, HDL cholesterol, and triglyceride levels in coronary artery disease patients. The Ser447-stop substitution in the lipoprotein lipase gene. REGRESS Study Group."

" To determine the effect of a common mutation (Ser447-Ter) of the human LPL gene upon serum lipid and lipoprotein levels and coronary artery disease (CAD) within a representative adult male population, we analyzed subjects from the Caerphilly Prospective Heart Disease Study (n = 1273). The possession of this mutation associates with protective lipid and lipoprotein profiles. Subjects possessing the mutation have significantly higher HDL-C (p = 0.002) and apo AI (p < 0.04) levels, lower triglycerides (p = < 0.04) and total cholesterol/HDL-C ratios (p < 0.02); all established previously to reduce risk of CAD. We also find that this mutation is significantly less frequent amongst CAD subjects (p < 0.05). These associations provide evidence for a common mutation that appears to confer beneficial lipid and lipoprotein profiles amongst an adult male population with regard to risk of CAD. "

"We have recently described a C825T polymorphism in the gene encoding for the Gbeta3 subunit of heterotrimeric G proteins. The 825T allele is associated with a novel splice variant (Gbeta3-s) and enhanced signal transduction via pertussis toxin (PTX)-sensitive G proteins. fMLP-induced chemotaxis, but not O2- generation, was increased in neutrophils with the TC/TT (EC50 = 1.5 +/- 1.3 nM) genotypes compared to the CC genotype (EC50 = 5.9 +/- 1.5 nM). Maximal fMLP-induced increase in [Ca2+]i was significantly reduced in neutrophils from individuals with TC/TT genotype vs. CC genotype (212.9 +/- 10.1 nM vs. 146.4 +/- 24.2 nM). Gbeta3-s appears to be associated with enhanced immune cell function in humans."

There's a couple of beneficial human mutations.

An antenna into a leg? A functional real leg? On it’s head I presume? Doing what? Does it have toes? Does it allow the fly to  walk upside down? Is this your example of a beneficial morphological mutation?

Let's slow down for one second.  It's a morphological mutation.  If you concede it's a mutation that causes morphological change, what do you propose prevents beneficial morphological mutations from occurring?  If you can't see how this is possible, look at a morphological change to vertabrae cells that lead to the formation of fins, as I posted above.

Except that hox genes only kick in after body plans are laid out….

And a mutation to the HOX genes can radically alter that body plan.  They can be duplicated and then the duplications can mutate.  So you can go from the segmented body of an insect to the vertabrae of a mammal, all through mutations and duplications of HOX genes.

as for the use of the word ‘overwhelming’ I have heard that adjective used in conjunction with fossil evidencefor evolution in the past and it turned out to be underwhelming.

Underwhelming for someone closed minded like you, who denies the evidence before they even examine it.  But to the objective paleontologist it is very enlightening.

Not the ones that have chosen to believe in natural processes as the explanation for all of life,

That's all of them.

but there are biologists that don’t believe it and I do believe that the numbers are increasing all the time.

You believe wrong.  Over 99.9% of the world's biologists fully acdcept the theory of evolution.  Please support your ridiculous claim or retract it.

Comparative anatomy doesn’t help you if there is no mechanism to change one organism into another.

That's funny, we have the mechanisms, they're called mutation and natural selection.

I hear this sort of hype so often, it just has no substance.

Of course it does.  Reptile to mammal evolution is so well supported that no biologist doubts it.  It is telling that you can't address the evidence and are forced to make vague, vapid remarks that are completely baseless.

Oh you mean like fruit flies giving rise to mutant fruit flies that they can’t mate with?

No, they are mutants.  And as you have been told, individual organisms don't evolve, populations evovle.  We have seen populations evovle in the lab and in the wild.

You know they are both fruit flies though, instinctively, don’t you?

Just as evolution predicts.  But they are different species, just as evolution predicts.

If you didn’t start with a presumption of naturalism

All science is is a study of naturalism, all science can investigate is naturalism.  Evolution is caused by observed natural processes, evolution is a fact.

That’s interpretation of data –not
evidence.


No, it's a conclusion based on the evidence, one you can't disprove and once again, you don't even try.

Nobody was there and no-one can know that that is what happened.

Sure we can, by studying the evidence, and it's conclusive.

In the case of evolution, it presupposes things and then believes it. Evolutionists don’t appear to understand how evolution differs fundamentally from real observational
science.


It presupposes nothing.  It is real observational science and virtually all biologists accept it as fact.

We can see it –all the parts work together. You can see it too –only you won’t acknowledge it as real design, you have to pretend it is just apparent design.

Another worthless, vague answer.  Life arising from non life is logical and theoretically possible and we're on the verge of recreating it.  Of course I won't aknoweldge it as intelligent design because it doesn't look intelligent at all.

Mutations are almost universally demonstrably harmful so I don’t believe that one animal evolved into another more complex form.

And you have been shown beneficial mutations, you've been shown mutations that radically alter body plans, mutations that caused fins to develope from vertabrae cells and you are forced to ignore them because they contradict your fantasy.

We can build a factory that produces a product but not even our brightest minds can produce a factory that produces another factory that produces something. I think that this designer of life is hardly an idiot –in fact I think that only fools could point to the perceived flaws and miss the big picture the way evoluionists do.You are all so blind!

Why give a totally sea going animal lungs???
Why design a sea going animal, with lungs, that has to dive to great depths of the ocean to eat and then have that animal suffer from the bends?  God must really hate whales!  Talk about blind...

OR we were created to walk upright and quite separate from the animals. The evidence doesn’t confirm for you what you believe, you interpret it that way, in fact you insist that that is the only possibility. So mutation causes negative effects mostly but humans evolved from quadrapeds. The evidence doesn’t matter to you, that is why I call it philosophy.

Sorry, are you saying we don't have a spine better suited to a quadruped that walks on all fours????  Or are yo usaying people don't get back aches, or are you saying Adam and Eve didn't get back aches?  Stick to the evidence, no need to bring your superstitions into science!

It may be a nice explanation but I don’t believe it is true –based on the evidence! It’s just a story that you believe. The people with back problems don’t stand up properly, they slouch, how about that explanation?

It stinks, it flies in the face of the evidence.
So your saying an "S" shaped spine is the optimal design for an upright mammal?  Please, do you EVER bother to think out your answers?

Hellooo! There may be more of us but we’re not getting better. Mutational load, thousands of mutational syndromes building up in the human population, wake up ! Just who’s being ridiculous here?!

Of course we're getting better, I'd like to see any evidence that we're not.  We live longer, are physically more robust, more healthy.  You make the crazy claim that mutational syndromes are building up in the human population, and yet you can show us no evidence for this.  When we look at reality, we see more humans than ever before, bigger and healthier humans than before.  So just how can you tell we're getting worse and worse, what is the physical evidence?

Lamarkism has been discredited a very long time ago. I’m talking about choices we have now. It still all boils down to ‘created or evolved’ (by whatever mechanism) –those are our two choices.

Right, this is exactly what you asked for, another choice besides evolution and how it was disproven.  That's how science works, creationism was disproven over 200 years ago by christian geologists, Lamarkism was disproven by direct observation and now only evolution is left standing.  It has been obsrved in the lab and in the wild, we understand some of it's mechanisms, we proactically apply it, it makes successful predictions, it explains the fossil record, it is a very useful fact in our modern life.
 


Posts: 1664 | Posted: 02:02 AM on July 16, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Comparative anatomy doesn’t help you if there is no mechanism to change one organism into another.
Mutation plus natural selection.


Most of the microvariation we see can be attributed to information already present in the genome -shuffling of alleles. Where mutation contributes, it does so by removing or distorting what was already there -there is no mechanism that has been demonstrated that causes integrated systems to build up via mutation. How do we know that that is what happened if it can't be demonstrated to be possible? That and the fossil record which demonstrates the lack of directional change and enormous gaps convinces me that it can't happen and it never did.



-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 05:50 AM on July 17, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 05:50 AM on July 17, 2009 :
Comparative anatomy doesn’t help you if there is no mechanism to change one organism into another.
Mutation plus natural selection.


Most of the microvariation we see can be attributed to information already present in the genome -shuffling of alleles. Where mutation contributes, it does so by removing or distorting what was already there -there is no mechanism that has been demonstrated that causes integrated systems to build up via mutation. How do we know that that is what happened if it can't be demonstrated to be possible? That and the fossil record which demonstrates the lack of directional change and enormous gaps convinces me that it can't happen and it never did.




Quote from Apoapsis at 12:37 PM on July 15, 2009 :
Quote from Lester10 at 08:30 AM on July 15, 2009 :
increased information due to mutation is directly observed.


Never has been observed before and I’m betting it never does.


You lost the bet.


   Contribution of individual random mutations to genotype-by-environment interactions in Escherichia coli
   Susanna K. Remold* and Richard E. Lenski

   Center for Microbial Ecology, Michigan State University, East Lansing, MI 48824

   Edited by M. T. Clegg, University of California, Riverside, CA, and approved July 30, 2001 (received for review March 22, 2001)

   Numerous studies have shown genotype-by-environment (G×E) interactions for traits related to organismal fitness. However, the genetic architecture of the interaction is usually unknown because these studies used genotypes that differ from one another by many unknown mutations. These mutations were also present as standing variation in populations and hence had been subject to prior selection. Based on such studies, it is therefore impossible to say what fraction of new, random mutations contributes to G×E interactions. In this study, we measured the fitness in four environments of 26 genotypes of Escherichia coli, each containing a single random insertion mutation. Fitness was measured relative to their common progenitor, which had evolved on glucose at 37°C for the preceding 10,000 generations. The four assay environments differed in limiting resource and temperature (glucose, 28°C; maltose, 28°C; glucose, 37°C; and maltose, 37°C). A highly significant interaction between mutation and resource was found. In contrast, there was no interaction involving temperature. The resource interaction reflected much higher among mutation variation for fitness in maltose than in glucose. At least 11 mutations (42%) contributed to this G×E interaction through their differential fitness effects across resources. Beneficial mutations are generally thought to be rare but, surprisingly, at least three mutations (12%) significantly improved fitness in maltose, a resource novel to the progenitor. More generally, our findings demonstrate that G×E interactions can be quite common, even for genotypes that differ by only one mutation and in environments differing by only a single factor.


How could an insertion mutation not be an example of increased information?





-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 06:01 AM on July 17, 2009 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 05:50 AM on July 17, 2009 :
Most of the microvariation we see can be attributed to information already present in the genome -shuffling of alleles.


Most?  How much?  What are the percentages?  Where are the numbers?


Where mutation contributes, it does so by removing or distorting what was already there -there is no mechanism that has been demonstrated that causes integrated systems to build up via mutation. How do we know that that is what happened if it can't be demonstrated to be possible? That and the fossil record which demonstrates the lack of directional change and enormous gaps convinces me that it can't happen and it never did.


Your need to believe this is theological.  Morton's Demon won't allow you to see anything else.



-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 06:24 AM on July 17, 2009 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Apoapsis
How could an insertion mutation not be an example of increased information?


Because a mutation of any kind is analogous to a spelling error. You might still get the protein that was coded for but if there's a demonstrable effect on that protein, it'll be deleterious. That's all that's ever been demonstrated.

Beneficial mutations are generally thought to be rare but, surprisingly, at least three mutations (12%) significantly improved fitness in maltose, a resource novel to the progenitor.


An example of increased fitness in a specific environment would be antibiotic resistance in bacteria where the loss or malfunction of a protein saves the bacteria where for example the protein that converts the antibiotic to a poison no longer functions. In this sort of scenario it has been demonstrated that the beneficial effect is only due to the loss of something, not a gain. It improves the bacteria's survival but only in that environment -there is a demonstrable fitness cost associated with the change that can be demonstrated when that mutated bacteria competes with the original parent population.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1554 | Posted: 07:19 AM on July 17, 2009 | IP
    
Multiple pages for this topic [ 1 2 3 4 5 ]

Topic Jump
« Back | Next »
Multiple pages for this topic [ 1 2 3 4 5 ]
Forum moderated by: admin
    

Topic options: Lock topic | Unlock topic | Make Topic Sticky | Remove Sticky | Delete thread | Move thread | Merge thread

 

© YouDebate.com
Powered by: ScareCrow version 2.12
© 2001 Jonathan Bravata. All rights reserved.