PRO

Where Your Ideas can change Minds

Please visit our new forum at

http://www.4forums.com

CON


YouDebate.com Forum
» back to YouDebate.com
Register | Profile | Log In | Lost Password | Active Users | Help | Board Rules | Search | FAQ |
Custom Search
» You are not logged in.   log in | register

  YouDebate.com Forum
   Creationism vs Evolution Debates
     Teaching ID is nonsensical
       Spare a thought for the teachers

Topic Jump
« Back | Next »
Multiple pages for this topic [ 1 2 ]
Forum moderated by: admin
    

    
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Name all the math based theories of Evolution


Genealogy is fairly relevant. We can tell precisely how different a specie is from another by comparing similarities between the genes. (ie: Disregarding the actual decimals that I’m too lazy to look up, homo sapiens are approximately 98% similar in genetic structure to that of a chimpanzee.) You cannot do that with Intelligent Design. You cannot examine a specie and say with any certainty whatsoever that it was designed a certain way, or that it was ‘this much’ designed. You can with Evolution.

please and match those up with the math based theories of chemistry.


Surely you’ve heard of biochemistry, which is in turn based on stoycheometry… Everything in science goes back to math, because math is the one thing in our universe that does not change.

You're actually disagreeing with other Eist with that statement, no big deal though.


Explain.

Because it's not hard science evolution has facts on some levels and "facts" on others. Evolution/ID analsis the past and make inferences based on the observations.


ID makes assertions—hardly inferences. And nonetheless, the inferences Evolution makes can be falsified; not so with ID.

If ID proves a directed process, to falsify it by proving things are the result of an undirected process.


That is not possible. An omnipotent being could have created our world two minutes ago, and scientifically, we can disprove that notion. But it’s still true. Therefore, even though the notion that we were created two minutes ago is potentially true, it is not scientific. How many bleeding times does this need to be explained? ID has the same concepts. It cannot be falsified, because even if every single iota of evidence pointed to Evolution, ID is still possible.



-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 4:13 PM on March 6, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Quote from EntwickelnCollin at 4:13 PM on March 6, 2006 :
Genealogy is fairly relevant. We can tell precisely how different a specie is from another by comparing similarities between the genes. (ie: Disregarding the actual decimals that I’m too lazy to look up, homo sapiens are approximately 98% similar in genetic structure to that of a chimpanzee.) You cannot do that with Intelligent Design. You cannot examine a specie and say with any certainty whatsoever that it was designed a certain way, or that it was ‘this much’ designed. You can with Evolution.


All that can easily point to common design. The math does not prove anything like in a hard science. It allows an inference


Surely you’ve heard of biochemistry, which is in turn based on stoycheometry… Everything in science goes back to math, because math is the one thing in our universe that does not change.


You what? I know the Pres of Germany, because my friends dad met him, and I know my friend, I'll just ride the wave in. No, let's not act like Evolution is synonomous with biochemistry.

Explain


You disagree with Mayr



ID makes assertions—hardly inferences. And nonetheless, the inferences Evolution makes can be falsified; not so with ID.


What's the difference in someone doing the same similarity testing and one saying common descent, the other common design, especially when homology was originated as a common design inference.


That is not possible. An omnipotent being could have created our world two minutes ago, and scientifically, we can disprove that notion. But it’s still true. Therefore, even though the notion that we were created two minutes ago is potentially true, it is not scientific. How many bleeding times does this need to be explained? ID has the same concepts. It cannot be falsified, because even if every single iota of evidence pointed to Evolution, ID is still possible.


I said nothing about God, only a directed, complex, process. The last sentence applies to homology and punc equil. The fossil record didn't fit the prediction so now it's evidence of evolution, we'll make the prediction fit the evidence. Homology was orignaly for common design, we'll take that say it's proof of evolution.



 


Posts: 96 | Posted: 01:37 AM on March 8, 2006 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

I said nothing about God, only a directed, complex, process. The last sentence applies to homology and punc equil. The fossil record didn't fit the prediction so now it's evidence of evolution, we'll make the prediction fit the evidence. Homology was orignaly for common design, we'll take that say it's proof of evolution.


Again: How can you scientifically disprove a process that can be true regardless of all evidence? I don't know how an explanation of how homology supposedly supports ID answers that.

All that can easily point to common design. The math does not prove anything like in a hard science. It allows an inference


No, it proves Evolution, because we watch DNA during speciation and the evolution of microscopic organisms. We watch these organisms evolve. They are not being designed and popping out of the air. We've learned that nucleic acid is the direct means for evolution to work in the first place, and we scientifically observe it happening. The math supports evolution, because it fits right in line with both how our predictions based on fossil evidence would think it should, and because it works the exact same way that DNA works now.

But regardless, ID can still be possible, even though you've presented nothing to suggest that DNA changed a different way millions of years ago.

You what? I know the Pres of Germany, because my friends dad met him, and I know my friend, I'll just ride the wave in. No, let's not act like Evolution is synonomous with biochemistry.


....?? I never said Biochemistry was synonymous with Evolution, though I am saying Evolution is based on Biochemistry, and Biochemistry is based on math.

You disagree with Mayr


That's your assertion; now for the second time, explain how.



What's the difference in someone doing the same similarity testing and one saying common descent, the other common design, especially when homology was originated as a common design inference.


The difference is the evidence presented. Changes in the DNA structure cause life to evolve as we speak, and it's no out-of-this-world inference to say DNA did the same thing millions of years ago, just as it's not out-of-this-world to say gravity worked the same way millions of years ago. I have an idea: observe an organism getting designed.

(Edited by EntwickelnCollin 3/8/2006 at 3:26 PM).

(Edited by EntwickelnCollin 3/8/2006 at 3:27 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 07:42 AM on March 8, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 01:37 AM on March 8, 2006 :
All that can easily point to common design. The math does not prove anything like in a hard science. It allows an inference


HUH???  Just what "hard" sciences are you familiar with?  You sound like someone speaking from wishes rather than experience.





-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 10:20 AM on March 8, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:



Again: How can you scientifically disprove a process that can be true regardless of all evidence? I don't know how an explanation of how homology supposedly supports ID answers that.


The first part has already been answered. All the similarity shown by homology points to everything being created by a similar process,  building blocks, or same supplies.


No, it proves Evolution, because we watch DNA during speciation and the evolution of microscopic organisms. We watch these organisms evolve. They are not being designed and popping out of the air. We've learned that nucleic acid is the direct means for evolution to work in the first place, and we scientifically observe it happening. The math supports evolution, because it fits right in line with both how our predictions based on fossil evidence would think it should, and because it works the exact same way that DNA works now.


Name the math theorms supporting Evolution.
All the math involved in homolgy proves how similar animals are, it doesn't prove common descent. What's the definition of homology?



But regardless, ID can still be possible, even though you've presented nothing to suggest that DNA changed a different way millions of years ago.


I already covered this.


....?? I never said Biochemistry was synonymous with Evolution, though I am saying Evolution is based on Biochemistry, and Biochemistry is based on math.


No, Evolutionary biology is a based on biochemistry. Several fields incorporate evolution. Nonetheless, evolution is not a math based science, it's subjective, like history.

That's your assertion; now for the second time, explain how.


The short version, he doesn't compare evolution to the other sciences like physics (math based). Evolution doesn't have any laws like in other sciences. *assertion?!?*
 

The difference is the evidence presented. Changes in the DNA structure cause life to evolve as we speak, and it's no out-of-this-world inference to say DNA did the same thing millions of years ago, just as it's not out-of-this-world to say gravity worked the same way millions of years ago. I have an idea: observe an organism getting designed.


(Edited by EntwickelnCollin 3/8/2006 at 3:26 PM).

(Edited by EntwickelnCollin 3/8/2006 at 3:27 PM).


Observing changes in DNA doesn't mean it's supported by Evolution. What theory supports the changing of DNA, gradualism, punc equil, please inform me? I have an idea too: observe a bacteria turning into a human.



 


Posts: 96 | Posted: 02:09 AM on March 9, 2006 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Milken is just getting ridiculous now.  Homologies point to a common process, yeah, evolution.  Common design?  Why would an all powerful designer use a common design?  No reason except it fits your religious fantasies.
If organisms arose independently, either naturally or supernaturally, we could logically expect each organism to have characteristics uniquely suited to it's nature and environment.
But what we actually see is all organisms have similarities with very different organisms that don't make sense functionally.  Why is a bat wing more similar to a human arm than a bird wing?  Why is a whale flipper more similar to tigers fore leg than it is to a shark fin?  If your claiming common designer, common design, explain what the plan is, why the designer made them that way.  Explain why the common designer would give whales vestigial legs, why the designer would allow whales to get the bends.  Evolution explains this, I have a more similar arm to a bat than a bird because we came from a more recent common ancestor.  What's your explaination, besides "Goddidit".
And explain to us why morphological homologies give us the same hierarchial relationships as genetic homolgies.  

Name the math theorms supporting Evolution.

Gee, I missed the part where real science is defined by how many "math theorms" it contains...Admit it, you just made that up!
From here:
EvoMath
"The mathematical modeling of evolution was profoundly elaborated in several directions: life origin models, mathematical population genetics, models of evolution of genetic regulatory systems, artificial life evolutionary models. These models provide us with better understanding of biological evolutionary phenomena; they also give generalized descriptions of biological experiments. Some models provide us with more abstract pictures – they describe artificial evolutionary processes: not the processes as-we-know-them, but the processes as-they-could-be. Thus, mathematical modeling of evolution is profound, well-elaborated, intensively developing field of theoretical investigations."

So there are quite a few "math theorms" in the theory of evolution, so I guess, by your definition, it's a real, hard science.

No, Evolutionary biology is a based on biochemistry. Several fields incorporate evolution. Nonetheless, evolution is not a math based science, it's subjective, like
history.


No, evolution, as I showed above, is a math based science, as much as any branch of science is math based.  It is subject to experimentation, obseration and examination of evidence, just like any other branch of science, so you are completely wrong to compare it to history.  Evolution is as objective as anything in science.

The short version, he doesn't compare evolution to the other sciences like physics (math based).

You don't understand science do you?  The theorms and equations in physics are attempts to systemize and explain our observations.  Since the fundamental forces in physics are so much harder to actually observe, since we understand them so poorly compared to the processes of evolution, evolution is a much better understood theory than many of the theories in physics.

I said nothing about God, only a directed, complex, process. The last sentence applies to homology and punc equil. The fossil record didn't fit the prediction so now it's evidence of evolution, we'll make the prediction fit the evidence. Homology was orignaly for common design, we'll take that say it's proof of evolution.

Still trying to claim punctuated equilibrium was proposed because the fossil record didn't fit with evolution?  Didn't you learn your lesson about this?  That's not why punc eek was proppsed.

All that can easily point to common
design.


Then explain how it points to common design.  Explain why an all powerful creator designed such an imperfect ecosystem here on earth.  And none of that "we can't know the mind of God" BS, give us a logical reason why a bat wing is more similar to a mammal arm than a bird wing, according to common design or your point is refuted.

You disagree with Mayr

I'm getting real tired of you making claims you can't back up, show us where Mayr says evolution ISN'T based on biochemistry...

All that can easily point to common design. The math does not prove anything like in a hard science. It allows an inference

But it's the only valid inference based on the evidence.  You haven't been able to explain why it points to common design!

What's the difference in someone doing the same similarity testing and one saying common descent, the other common design, especially when homology was originated as a common design inference.

Because common design wouldn't postulate organisms with disimilar life styles and disimilar environments to have similar structures and characteristics.  This gets back to the questions you couldn't answer, why is a bat wing more similar to a mammilian arm than a bird wing?  Why do whales have vistigial legs?  Why do birds have the genetic code for producing teeth?  

ID, if proposed does not have to mention the G-word, but an unknown directed
process.


Whether it mentions the G-word or not, there is absolutely no evidence for an intelligent, directed process and much evidence against it.


 


Posts: 1664 | Posted: 04:55 AM on March 9, 2006 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

The first part has already been answered. All the similarity shown by homology points to everything being created by a similar process,  building blocks, or same supplies.


You have not answered the question. Once more: How can you scientifically disprove a process that can be true regardless of all evidence?

You're only proving my point by continuing to go off on these investigations of homology. Anything in this universe can point to a "design" if you look hard enough. If you truly wanted to, you could claim patterns of dice rolls are designed, and there would be no way to refute the claim, just as you can claim a designer created every individual specie's gene code. How can you be sure whatsoever? Do you mean only to show that it's possible a designer created everything? If that's your point, you have a lot more ground than you think, but science isn't about what's possible; rather a process of verification. You can't apply that verification to Intelligent Design. You haven't explained how, at any rate.

Name the math theorms supporting Evolution.


We'll kill two birds with one stone, since Demon already spent a deal of time on the math involved in homology:

Chemical reactions: Sugar, phosphates, proteins, amino acids ---> nucleic acid nucleotide

Nucleotides arranged in specific order = specific gene

Time x (Nucleotides + radiation) = mutated gene

Time x (Mutated gene x Specie A) = Specie B

That's not math, huh? The biochemistry of DNA?

Of course, if you want to play this game hardcore, I'm going to request of you the math concepts that the intelligent designer utilized in order to defy his own Laws of Conservation.




-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 07:49 AM on March 9, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.


OK, to start with, Hardy-Weinberg Equilibrium.

Hardy-Weinberg Wiki article




-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 09:56 AM on March 9, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.


Wright-Fisher model of genetic drift.

Genetic Drift




-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 12:09 PM on March 10, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.


Fokker-Planck

Punctuated Equilibrium  Due to Epistasis


-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 09:41 AM on March 13, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.

Lotka-Volterra




-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 3:43 PM on March 14, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.



Jukes-Cantor







-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 4:05 PM on March 15, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.


Tamura - Nei Correction




-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 11:37 AM on March 16, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Thank you for proving and missing the point.

Lotka article
These models are computationally intensive, and don't necessarily illuminate the system dynamics.

Tamura article
But it is possible - Felsenstein defines a maximum likelihood method that searches for a MLE estimate of the phylogenetic distance between two sequences with mutation rates estimated from the actual sequences.

Assumes they descended from common ancestors.

Jukes - Cantor Correction
Assumes they descended from common ancestors. Almsot not relevant


Fokker-Planck (interesting name)

Computer Based Simulaton, seriously, as if the simulation is indicative of real life. CBS is the cornerstone of fact free sciecne.


I'm finished with this. I refuse to waste the time. A science that uses math is not a math based science, there is a difference. Thank you for showing me all the mathematical generalizations, once again you all are disagreeing with other Eist on this one.

 


Posts: 96 | Posted: 05:15 AM on March 18, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Quote from Demon38 at 04:55 AM on March 9, 2006 :
Milken is just getting ridiculous now.


I love it! = )

Quote from Demon38 at 04:55 AM on March 9, 2006 :
 Homologies point to a common process, yeah, evolution.  Common design?  Why would an all powerful designer use a common design?  No reason except it fits your religious fantasies.
If organisms arose independently, either naturally or supernaturally, we could logically expect each organism to have characteristics uniquely suited to it's nature and environment.


For the most part animals do fit their environment. No grizzly bears in the N. Pole, animals shed fur, birds fly south or north, etc

If I give you nails, plasitc, wood, glass, and steel(of course a few other things) you can build just about everything that's ever been built, common design, I'm done.

Homology was invented for common design.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
But what we actually see is all organisms have similarities with very different organisms that don't make sense functionally.


It's called coincidence. We only have several million species classifited and I don't know hundreds of millions of species have lived, and you think it's odd to have overlapping similarities, you're kidding.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
 Why is a bat wing more similar to a human arm than a bird wing?  Why is a whale flipper more similar to tigers fore leg than it is to a shark fin?  


Who knows but that's why they're classified as mammals. I'm no expert. Or there could have been mini-bat people, homo batius. Or walking whales, whales erectus.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
If your claiming common designer, common design, explain what the plan is, why the designer made them that way.  


I wasn't around when the directed process go things going. If it is a person and you see him, please ask.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
 Explain why the common designer would give whales vestigial legs, why the designer would allow whales to get the bends.  Evolution explains this,  


I explained it too.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
I have a more similar arm to a bat than a bird because we came from a more recent common ancestor.  What's your explaination, besides "Goddidit".  


I have a more similar arm to a bat than a bird IS NOT and explaination for common descent. They're similar because they're similar. Similarity does not prove the mechanism by which the similarity arrived. We already had a discussion about this where I showed you how circular it was, remember. Similarity by common descent is due to similarity, actually the way you put it was really funny.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
And explain to us why morphological homologies give us the same hierarchial relationships as genetic homolgies.  


Why, it's not even against design. We know DNA stores a code for organisms we'd expect the blueprint to resemble the building. Genes don't always account for physical similarity. If you've kept up with you Eist studies you'd know that.

Name the math theorms supporting Evolution.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
Gee,  


Is it still cool to say 'Gee'?

Quote from Demon38 at 04:55 AM on March 9, 2006 :
I missed the part where real science is defined by how many "math theorms" it contains...Admit it, you just made that up!


I admit it. I didn't make it up, already answered this.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
So there are quite a few "math theorms" in the theory of evolution, so I guess, by your definition, it's a real, hard science.


I don't think you're familiar with other areas science, like physics make sure you don't get together with Apostais.

No, Evolutionary biology is a based on biochemistry. Several fields incorporate evolution. Nonetheless, evolution is not a math based science, it's subjective, like
history.


The short version, he doesn't compare evolution to the other sciences like physics (math based).

Quote from Demon38 at 04:55 AM on March 9, 2006 :
You don't understand science do you?  The theorms and equations in physics are attempts to systemize and explain our observations.  Since the fundamental forces in physics are so much harder to actually observe, since we understand them so poorly compared to the processes of evolution, evolution is a much better understood theory than many of the theories in physics.


I'm going to give you some time to consort with all the other Demons and get the story straight. Which one of you uses that phrase,"I demand that you retract that statement". I can't wait until you say that again.

You're absoluely wrong. In physics, you give an idea do the math, if it equals out it's good add a few observations and it's great. Some of physics is repeatable, telescopes can actually see into the past if you understand that. You're really speaking from ignorance, I think Entwich can tell you that.

Quote from Demon38 at 04:55 AM on March 9, 2006 :
Then explain how it points to common design.  Explain why an all powerful creator designed such an imperfect ecosystem here on earth.  And none of that "we can't know the mind of God" BS, give us a logical reason why a bat wing is more similar to a mammal arm than a bird wing, according to common design or your point is refuted.


It's true we can't, and don't have too. It adds more subjectivity to an already subjective science. There are different theistic views to take. I see you like bats.

It's not that imperfect, it's been working for well over 4 billion years. Actually if you wanted me to answer, I'd say it's suppose to be perfect anymore, it's suppose to slowly decline.

You disagree with Mayr

I'm getting real tired of you making claims you can't back up, show us where Mayr says evolution ISN'T based on biochemistry...

All that can easily point to common design. The math does not prove anything like in a hard science. It allows an inference

But it's the only valid inference based on the evidence.  You haven't been able to explain why it points to common design!

What's the difference in someone doing the same similarity testing and one saying common descent, the other common design, especially when homology was originated as a common design inference.

Because common design wouldn't postulate organisms with disimilar life styles and disimilar environments to have similar structures and characteristics.  This gets back to the questions you couldn't answer, why is a bat wing more similar to a mammilian arm than a bird wing?  Why do whales have vistigial legs?  Why do birds have the genetic code for producing teeth?  

ID, if proposed does not have to mention the G-word, but an unknown directed
process.


Whether it mentions the G-word or not, there is absolutely no evidence for an intelligent, directed process and much evidence against it.






 


Posts: 96 | Posted: 06:09 AM on March 18, 2006 |
IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

For the most part animals do fit their environment. No grizzly bears in the N. Pole, animals shed fur, birds fly south or
north, etc


Once again, you ignore the point!  Why are bat wings different from bird wings?  Same environment, different structure, where's your explaination?  I'm not talking about organisms fitting their environment,  I'm talking about HOW they fit their environment.  

If I give you nails, plasitc, wood, glass, and steel(of course a few other things) you can build just about everything that's ever been built, common design, I'm done.

You most certainly are done!  You ignore everything that refutes your point, everything you can't answer!  You keep ignoring the fact that common design does not apply here, bat's wings different than birds wings, whale fins different from fish fins....Why didn't the common designer use a common design?  Of course, your only answer is something like, "we can't know the mind of God....", a scientifically worthless answer.

Homology was invented for common
design.


Too bad it doesn't support common design, it supports evolution.

It's called coincidence. We only have several million species classifited and I don't know hundreds of millions of species have lived, and you think it's odd to have overlapping similarities, you're kidding.

You don't understand homologies...  Coincidence? All mammals have hair, produce milk is a coincidence?  Oh that's right according to you, mammals aren't related, in fact, according to you, no animals are related.  No, we see nested groups of related organisms, the best explaination for these nested groups is evolution.  And these nested groups are confirmed by genetics.  Your position just keeps getting sillier and sillier...

Who knows but that's why they're classified as mammals.

But according to you there are no homologies, so when we classify animals in groups, we classify them arbitrarily due to conincidence!  Brilliant!

I'm no expert.

That's glaringly apparent!

I wasn't around when the directed process go things going. If it is a person and you see him, please ask.

In other words, "Goddidit!"...

I have a more similar arm to a bat than a bird IS NOT and explaination for common descent.

No but it is evidence for common descent.  What's your better explaination?  Oh, right, you don't have one...

They're similar because they're similar. Similarity does not prove the mechanism by which the similarity arrived.

Of course it is!

We already had a discussion about this where I showed you how circular it was, remember.

Ridiculous!  You showed no such thing!  In fact, you ran away when the questions got too tough for you, just like you're doing here.

Similarity by common descent is due to similarity, actually the way you put it was really funny.

Well, you obviously don't understand it, you keep avoiding answering the questions, so I guess you either have to laugh or cry at your ignorance...

Why, it's not even against design. We know DNA stores a code for organisms we'd expect the blueprint to resemble the building. Genes don't always account for physical similarity. If you've kept up with you Eist studies you'd know that.

That's not true at all!  Morphological similarities are completely supported by genetic similarities!  So basically you're saying genetic similarities are also completely coincidental.  Sorry, evolution is still the best explaination for the diversity of life, it's still solid evidence for life's divergence from a common ancestor, homologies still support evolution.

Is it still cool to say 'Gee'?

Who cares, you dodge the questions you can't answer, how cool is that?

I don't think you're familiar with other areas science, like physics make sure you don't get together with Apostais.

You were shown some of the math behind evolution, what's your response?  Evolution is backed up by just as much math as any other science.

No, Evolutionary biology is a based on biochemistry. Several fields incorporate evolution. Nonetheless, evolution is not a math based science, it's subjective, like
history.


Since we can observe fossils, since we can conduct experiments on living organisms, since we can test evolutionary processes, it's not a historical science, you are wrong.

You're absoluely wrong. In physics, you give an idea do the math, if it equals out it's good add a few observations and it's great.

But the math is just an attempt to describe physical phenomenon!  Same as evolution!  You don't understand physics either!

It's true we can't, and don't have too. It adds more subjectivity to an already subjective science. There are different theistic views to take. I see you like bats.

Bats are such a good example!  And you keep avoiding it!  Your only answer is "Goddidit!"
This is a scientifically worthless answer.  You ignore the fact that evolution is the unifying concept of biology and it's practical application has greatly benefitted mankind.

All that can easily point to common design. The math does not prove anything like in a hard science. It allows an inference

Wrong.  Mayr accepts the theory of evolution, so you disagree with Mayr.  Common design is a vague, worhtless claim that can't be supported, similarities don't support common desing.

Once again, here's what I posted, and what you ignore:
"Because common design wouldn't postulate organisms with disimilar life styles and disimilar environments to have similar structures and characteristics.  This gets back to the questions you couldn't answer, why is a bat wing more similar to a mammilian arm than a bird wing?  Why do whales have vistigial legs?  Why do birds have the genetic code for producing teeth?"

Common design is not supported by the evidence.  

 


Posts: 1664 | Posted: 1:46 PM on March 18, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Once again, you ignore the point!  Why are bat wings different from bird wings?  Same environment, different structure, where's your explaination?  I'm not talking about organisms fitting their environment,  I'm talking about HOW they fit their environment.  

I didn't ignore I answered it later in the post, read please.

If I give you nails, plasitc, wood, glass, and steel(of course a few other things) you can build just about everything that's ever been built, common design, I'm done.

You most certainly are done!  You ignore everything that refutes your point, everything you can't answer!  You keep ignoring the fact that common design does not apply here, bat's wings different than birds wings, whale fins different from fish fins....Why didn't the common designer use a common design?  Of course, your only answer is something like, "we can't know the mind of God....", a scientifically worthless answer.

Common design does not state every feature will be the same, but it's still a wing and it's still a fin.

You don't understand homologies...  Coincidence? All mammals have hair, produce milk is a coincidence?

Yes, I understand homology(similarity due to common descent). Let me reiterate, given hundred of millions of species in the existence of the planet, ofcourse we can classify them into groups.

 Oh that's right according to you, mammals aren't related, in fact, according to you, no animals are related.

I believe they're similar but not by means of common descent. In a sense, animals are related.

No, we see nested groups of related organisms, the best explaination for these nested groups is evolution.  And these nested groups are confirmed by genetics.  Your position just keeps getting sillier and sillier...

   No, we see millions of animals and we put them into nested groups. Genetics confirms we've done a good job of selecting these groups. Ofcourse they will be genetically similar if they're similar in various other ways.
   Genetics also confirms we're more similar to corn than other simple organisms, I don't know, it's weird.


But according to you there are no homologies, so when we classify animals in groups, we classify them arbitrarily due to conincidence!  Brilliant!

False, there are similarites but I disagree with the mechanism(common descent). You continually fail to grasp this concept. Please define homology, what's your definition?


In other words, "Goddidit!"...

I didn't know you felt that way.

I have a more similar arm to a bat than a bird IS NOT and explaination for common descent.

I mentioned this above. WOW, maybe it's a transitional form, so batmen really exist! We don't have fossils because they evolved so quickly in the outskirts of the main population and became extinct, leaving no record.

No but it is evidence for common descent.  What's your better explaination?  Oh, right, you don't have one...

My concern is explaining the mechanism that causes similarity.

They're similar because they're similar. Similarity does not prove the mechanism by which the similarity arrived.

Of course it is!

So in proving that something is similar, it proves common descent?



Ridiculous!  You showed no such thing!  In fact, you ran away when the questions got too tough for you, just like you're doing here.


You really don't remember. I don't want to go through the trouble of posting it here.

That's not true at all!  Morphological similarities are completely supported by genetic similarities!  So basically you're saying genetic similarities are also completely coincidental.  Sorry, evolution is still the best explaination for the diversity of life, it's still solid evidence for life's divergence from a common ancestor, homologies still support evolution.

Humans are also more similar to corn than some simple organisms. I'm not saying it's coincidence per say but if they're morphologically similiar they should be genetically similar, overall.


Who cares, you dodge the questions you can't answer, how cool is that?

I don't dodge and I'm oh so cool.


Since we can observe fossils, since we can conduct experiments on living organisms, since we can test evolutionary processes, it's not a historical science, you are wrong.

It's more historical because it deals with the interpretation of past information and occurrences. Only a non-math person asserts E is a math based science. How many equations did Darwin need to come up with the theory.       Mayr agrees with my assertion(historical process) and if you think I'm lying that's fine.
 If I said it wasn't a historical process you would swear it was.


But the math is just an attempt to describe physical phenomenon!  Same as evolution!  You don't understand physics either!

The math in the fields do not carry the same weight. If you're not into math you'd make these kinds of statements. An evolutionary biologist doesn't need a serious math background, you can't be physicist without one.

[b]Bats are such a good example!  And you keep avoiding it!  [\b]

No, you keep failing to read it.

[b]  You ignore the fact that evolution is the unifying concept of biology [\b]

LOL. Name one unambigous example of evolution to a higher taxaa. OR Name the experiment proving how prokaryotes(asexual) evolved into eukaryotes(sexual)

[b] and it's practical application has greatly benefitted mankind. [\b]

I agree it's benefited mankind, only because I'm objective.

[b]Wrong.  Mayr accepts the theory of evolution, so you disagree with Mayr.  Common design is a vague, worhtless claim that can't be supported, similarities don't support common desing.[\b]

Yes but we agree that evolution is not math based, doesn't have "laws" that hold the same weight as in other math based fields, and evolution is more a historical process.

[b]Once again, here's what I posted, and what you ignore:
"Because common design wouldn't postulate organisms with disimilar life styles and disimilar environments to have similar structures and characteristics.  [\b]

Has nothing to do with common design as far as I know.

[b]  Why do birds have the genetic code for producing teeth?"[\b]

Because some birds have/had teeth, duh!

[b]Common design is not supported by the evidence.  [\b]

Neither is your delusional state.
 


Posts: 96 | Posted: 01:12 AM on March 20, 2006 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

I didn't ignore I answered it later in the post, read please.

If I give you nails, plasitc, wood, glass, and steel(of course a few other things) you can build just about everything that's ever been built, common design, I'm done.


God’s resources aren’t limited whatsoever. That alone should be enough to throw the logic of that claim out the window, but even so, a bat’s wings are not similar to a bird’s wings. Evidence, God had to buy some hair and mammalian skin in order to make his bats.

Common design does not state every feature will be the same, but it's still a wing and it's still a fin.


Common design states common design. It wouldn’t fly if an evolutionist were to say “Common descent does not state every feature descended from something else,” and it doesn’t fly when you keep trying to evade the obstacle in front of you. This is exactly what Zerocool attacked in his post—the one you applauded him for—yet it couldn’t be clearer that you’re doing exactly what he condemned.

Yes, I understand homology(similarity due to common descent). Let me reiterate, given hundred of millions of species in the existence of the planet, ofcourse we can classify them into groups.


Given the truly infinite number of possibilities an omnipotent designer could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.

I mentioned this above. WOW, maybe it's a transitional form, so batmen really exist! We don't have fossils because they evolved so quickly in the outskirts of the main population and became extinct, leaving no record.


If the evolving populations became extinct, they wouldn’t have have descendants.

So in proving that something is similar, it proves common descent?


Stop ignoring the point I keep making about DNA being observed to cause evolution, the same way we predicted it would, the same way that happens to line up with homology. When the AIDS virus mutates, new strands of DNA aren’t magically popping out in the viruses’ offspring.


I don't dodge and I'm oh so cool.


You’ve dodged, for the third time now, my mentioning of experimental science for evolution coinciding with evidential science for evolution.

It's more historical because it deals with the interpretation of past information and occurrences. Only a non-math person asserts E is a math based science.


You’ve already been destroyed over this, as Apoapsis continues to provide examples of math-orientated sections of evolutionary theory that are directly supported by DNA and fossil evidence.

How many equations did Darwin need to come up with the theory.       Mayr agrees with my assertion(historical process) and if you think I'm lying that's fine.
If I said it wasn't a historical process you would swear it was.


Not Mayr! I suppose the argument’s lost now that you’ve got a handful of quotes from scientists who don’t even challenge evolutionary theory to begin with.

The math in the fields do not carry the same weight. If you're not into math you'd make these kinds of statements. An evolutionary biologist doesn't need a serious math background, you can't be physicist without one.


Biochemists (the guys who deal with DNA) need a lot of math background. Zoologists, on the other hand, deal with in-tact organisms, at a much higher level than the molecule-by-molecule work of a biochemist.

[b]  You ignore the fact that evolution is the unifying concept of biology [\b]

LOL. Name one unambigous example of evolution to a higher taxaa. OR Name the experiment proving how prokaryotes(asexual) evolved into eukaryotes(sexual)


………What? Are you trying to act blind right now? Your response didn’t even have anything to do with the statement.

I agree it's benefited mankind, only because I'm objective.


That was your ploy a couple weeks or so ago. It ain’t working anymore though.

[b]Wrong.  Mayr accepts the theory of evolution, so you disagree with Mayr.  Common design is a vague, worhtless claim that can't be supported, similarities don't support common desing.[\b]

Yes but we agree that evolution is not math based, doesn't have "laws" that hold the same weight as in other math based fields, and evolution is more a historical process.


It does not need to be math based to begin with, as we’ve already established. Ignoring the fact that a lot of evolutionary theory is math based, your reply was yet again, unresponsive to the question.

[b]  Why do birds have the genetic code for producing teeth?"[\b]

Because some birds have/had teeth, duh!


After they evolved from those reptilian stages in the line, yes. But we’re talking about the birds without teeth that still have genetic data referencing to teeth, without showing it in their phenotypic ratios.

[b]Common design is not supported by the evidence.  [\b]

Neither is your delusional state.


Is that a "no," then? Common Design isn't supported by the evidence?



-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 01:47 AM on March 20, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

The return of 39 against 1.

God’s resources aren’t limited whatsoever. That alone should be enough to throw the logic of that claim out the window, but even so, a bat’s wings are not similar to a bird’s wings. Evidence, God had to buy some hair and mammalian skin in order to make his bats.


Do you believe in God? The logic was meant to apply to everyday life not God.

Common design states common design. It wouldn’t fly if an evolutionist were to say “Common descent does not state every feature descended from something else,” and it doesn’t fly when you keep trying to evade the obstacle in front of you. This is exactly what Zerocool attacked in his post—the one you applauded him for—yet it couldn’t be clearer that you’re doing exactly what he condemned.


I see Zerocool has really gotten to you. Actually I applauded the humor of the post the most, some of the claims I'm not aware of. A Creationist could state it better but God essentially made nested groups you could say. He made natural kinds. Probaly defined as groups capable of reproducing with each other.

Given the truly infinite number of possibilities an omnipotent designer could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.


It's not suppose to be as your suggesting.
Given the truly infinite number of possibilities  natural selection could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.

I mentioned this above. WOW, maybe it's a transitional form, so batmen really exist! We don't have fossils because they evolved so quickly in the outskirts of the main population and became extinct, leaving no record.


If the evolving populations became extinct, they wouldn’t have have descendants.


Remember, evolution doesn't happen in a straight line.

Stop ignoring the point I keep making about DNA being observed to cause evolution, the same way we predicted it would, the same way that happens to line up with homology. When the AIDS virus mutates, new strands of DNA aren’t magically popping out in the viruses’ offspring.


I don't mind if you don't answer. If two organisms are physically similar I don't think it's much of a prediction to assume they'll have similar DNA. Since the directed information in the DNA caused the similarity.


You’ve already been destroyed over this, as Apoapsis continues to provide examples of math-orientated sections of evolutionary theory that are directly supported by DNA and fossil evidence.


Everyone knows there's math involved in biochemistry, not as much in biology. I refuted it throughly, it's external math which is great, I'm aware of it.

Not Mayr! I suppose the argument’s lost now that you’ve got a handful of quotes from scientists who don’t even challenge evolutionary theory to begin with.


Saying E is a historical process and evolutions "laws" (maybe it's from a biology view) aren't the same as in other areas of science. Mayr also mentions, Rensch. But it's just his opinion.


LOL. Name one unambigous example of evolution to a higher taxaa. OR Name the experiment proving how prokaryotes(asexual) evolved into eukaryotes(sexual)

………What? Are you trying to act blind right now? Your response didn’t even have anything to do with the statement.


Well, it's now okay to call Strings the unifying theory of physics without proving, that was the point.


That was your ploy a couple weeks or so ago. It ain’t working anymore though.


What do you mean? I do thing E has greatly benefited science.


It does not need to be math based to begin with, as we’ve already established.


I agree, it doesn't have to be.

After they evolved from those reptilian stages in the line, yes. But we’re talking about the birds without teeth that still have genetic data referencing to teeth, without showing it in their phenotypic ratios.


All animals have genes that are off or not selected


 


Posts: 96 | Posted: 03:37 AM on March 20, 2006 |
IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Do you believe in God? The logic was meant to apply to everyday life not God.


Common Design doesn’t apply to everyday life…

I see Zerocool has really gotten to you. Actually I applauded the humor of the post the most, some of the claims I'm not aware of.


Where do you draw that? It seemed you agreed with Zerocool’s point, so I showed a contradiction. The post itself was unlike anything I’d expect from Zerocool, however, after he threw half a thesaurus at me in the debate thread. Zerocool’s temper and ability as a rhetoritician got to me, while his other post made me question if it was even the same person.

A Creationist could state it better but God essentially made nested groups you could say. He made natural kinds. Probaly defined as groups capable of reproducing with each other.


I really hope you’re not trying to imply that with the tiny amount of animals Noah could have fit on his Ark, that it would then be possible for those animals to expand in number and variety without Natural Selection getting involved.


It's not suppose to be as your suggesting.
Given the truly infinite number of possibilities  natural selection could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.

I mentioned this above. WOW, maybe it's a transitional form, so batmen really exist! We don't have fossils because they evolved so quickly in the outskirts of the main population and became extinct, leaving no record.



That does not answer anything pertaining to my statement.


If the evolving populations became extinct, they wouldn’t have have descendants.



Remember, evolution doesn't happen in a straight line.


Populations require descendents, no matter how dissimilar those descendants are from the rest of the population.

I don't mind if you don't answer. If two organisms are physically similar I don't think it's much of a prediction to assume they'll have similar DNA. Since the directed information in the DNA caused the similarity.


You are becoming awfully frustrating. I’ll repeat: Stop ignoring the point I keep making about DNA being observed to cause evolution

You just ignored it AGAIN. For the LAST time: WE WATCH DNA CAUSE EVOLUTION. It is not just a matter of noting similarities. I’m talking about the mutation of DNA, not simply its presence in dictating the phenotypic appearance of an organism. In laboratories, where viruses and bacteria are closely scrutinized, we observe pathogens and other microorganisms from one generation to the next, and we see them evolving! After changing some kind of factor in their environment, like the amount of heat they are exposed to, their DNA changes in the cellular reproduction stage of meiosis, and suddenly we have a brand new pathogen swarming over the Petri dish, which is miraculously tolerant to the new factor we changed in their environment. Let’s see if you try to say “Similar organisms have similar DNA,” as a response again.


Everyone knows there's math involved in biochemistry, not as much in biology. I refuted it throughly, it's external math which is great, I'm aware of it.


Biology all depends on biochemistry. This was my point earlier. Biology all depends on the chemistry of organic substances. If that chemistry stops working, not a single organism known to man could survive.

Saying E is a historical process and evolutions "laws" (maybe it's from a biology view) aren't the same as in other areas of science. Mayr also mentions, Rensch. But it's just his opinion.


Precisely.



All animals have genes that are off or not selected


That’s not true. The genes are not “off” until an animal finds itself in a tight spot. If the only food laying around was in the form of thick, fibery branches of trees and leaves containing little else than cellulose, a bird wouldn’t sprout teeth and just go to town. Same thing applies to human beings with our appendix. If you chow down on the greens, your appendix isn’t going to suddenly wake up and do something for a change.


(Edited by EntwickelnCollin 3/20/2006 at 8:36 PM).


-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 09:41 AM on March 20, 2006 | IP
Demon38

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Common design does not state every feature will be the same, but it's
still a wing and it's still a fin.


What exactly does common design state?  As to bat wings and bird wings,
whale fins and fish fins, you dodge the point of the question, a bat's wing
and a bird's wing are superfically similar because they do the same thing,
allow them to fly, why are they structurally different then?  Why do
humans, who aren't superficially similar to bats and who live in a
completely different environment, still have a stucturally similar forearm
with bats?  Evolution explains it nicely, because we evolved from a more
recent common ancestor than birds and bats, how does ID explain it?

Yes, I understand homology(similarity due to common descent). Let me
reiterate, given hundred of millions of species in the existence of the
planet, ofcourse we can classify them into groups.


But what is the basis of these classifications?  According to you, are
these classifications based on relatedness?  And if they are, how are
animals related.  Because your stance is that nothing is related...

I believe they're similar but not by means of common descent. In a
sense, animals are related.


How?

No, we see millions of animals and we put them into nested groups.
Genetics confirms we've done a good job of selecting these groups. Ofcourse
they will be genetically similar if they're similar in various other ways.
  Genetics also confirms we're more similar to corn than other simple
organisms, I don't know, it's weird.


But here's where your argument completely falls apart.  Why would
dissimilar organisms, in different environments still have homologies?
With ID, you would expect animals living in similar environments to be
genetically and morphologically similar, but we don't see that!
You say "Ofcourse they will be genetically similar if they're similar in
various other ways. "
But what we actually see is dissimilar organisms, living in different
environments, have similar underlying structural similarities and genetic
similarities.  The only explaination that makes sense is evolution.  Bats
have a wing that is based on a modified mammalian forearm, not a bird wing,
bats are more genetically similar to other mammals, not birds.
And provide a source for your "corn story", because it's meaningless
without a source.

False, there are similarites but I disagree with the mechanism(common
descent). You continually fail to grasp this concept. Please define
homology, what's your definition?


Here's a good definition of homolgy:
rel="nofollow]Homology
"Homology is a specific explanation of similarity of form seen in the
biological world. Similarities can often be explained by common descent;
features are considered homologous if they are shown to be inherited from a
common ancestor. For example, although the arms of four-limbed vertebrates
externally appear quite different, all have the same basic underlying
skeletal and muscular pattern. Such shared patterns are best explained by
the inference that they were inherited from a common ancestor that also had
this pattern. Proposed homologies are evaluated using comparative anatomy,
genetics, development, and behavior."

Why are there similarities?  God trying to fool us?  It isn't because they
live in similar environments, what else is there?  Evolution explains it
nicely and is supported by all the evidence, nothing else explains it.

I mentioned this above. WOW, maybe it's a transitional form, so batmen
really exist! We don't have fossils because they evolved so quickly in the
outskirts of the main population and became extinct, leaving no record.


Still dodging the question.

My concern is explaining the mechanism that causes similarity.

They're similar because they're similar. Similarity does not prove the
mechanism by which the similarity arrived.


So you can't explain why they're similar.  And since we can study the
stucture of the bat wing, the mammilian forearm and the bird wing,
homologies do support evolution.

So in proving that something is similar, it proves common descent?

All according to what you mean by 'similar'.  As I posted above, homologies
are determined by more than looking at 2 organisms and saying "yeah, they
look similar...."  From here:
rel="nofollow]HomologyII
"Today, biologists still diagnose homologous structures by first searching
for structures of similar form and position, just as pre-Darwinian
biologists did. (They also search for genetic, histological, developmental,
and behavioral similarities.) However, in our post-Darwin period,
biologists define a homologous structure as an anatomical, developmental,
behavioral, or genetic feature shared between two different organisms
because they inherited it from a common ancestor. Because not all features
that are similar in two organisms are necessarily inherited from a common
ancestor, and not all features inherited from a common ancestor are
similar, it is necessary to test structures before they can be declared
homologous. To answer the question, "could this feature in these groups be
inherited from a common ancestor?" scientists compare the feature across
many groups, looking for patterns of form, function, development,
biochemistry, and presence and absence. Many features are tested
simultaneously against genealogy through a process that Kluge (1997; see
also Kluge, 1998, 1999 for discussions of independent homology tests)
termed testing "multiple ad hoc hypotheses of homology."
If, considering all the available evidence, the distribution of
characteristics across many different groups resembles a genealogical
pattern, it is very likely that the feature reflects common ancestry.
Future tests based on more features and more groups could change those
assessments, however -- which is normal in the building of scientific
understanding. Nevertheless, when a very large amount of information from
several different areas (anatomy, biochemistry, genetics, etc.) indicates
that a set of organisms is genealogically related, then scientists feel
confident in declaring the features that they share are homologous.
Finally, while judgments of homology are in principle revisable, there are
many cases in which there is no realistic expectation that they will be
overturned."

You really don't remember. I don't want to go through the trouble of
posting it here.


What I don't remember is you showing any circularity!

Humans are also more similar to corn than some simple organisms. I'm not
saying it's coincidence per say but if they're morphologically similiar
they should be genetically similar, overall.


I still don't buy your "corn story" until I see a source that supports
it....And yes you are saying genetic similarity is a coincidence.  And the
problem for creationism is that we see animals that are superficially
dissimilar, living in different environments, that are stucturally similar
and genetically similar.   That kills your point completely.

I don't dodge and I'm oh so cool.

Whether you're cool or not doesn't matter to me, but you keep dodging the questions you can't answer.

It's more historical because it deals with the interpretation of past information and occurrences.

What about genetics, that's evidence that's not historical, that we can observe, test, experiment on right now.  According to your definition here, that makes geology historical, astronomy historical also.  Are they wrong too?

Only a non-math person asserts E is a math based science.

Apoapsis has showed you all kinds of math that's a part of the theory of evolution, I must have missed the part where you refuted that....

Mayr agrees with my assertion(historical process) and if you think I'm lying that's
fine.


Of course evolution happened in the past, and Mayr would agree, but we examine evidence in the present so biology isn't just historical.  Mayr knows this, he says it's a historical process, not that evolution is merely based on historical observation.

The math in the fields do not carry the same weight.

Why not?  The math in both fields is used to describe physical phenomenon, I don't see the difference and you haven't shown us any, besides your own sense of incredulity...

No, you keep failing to read it.

No, you keep dodging it.

LOL. Name one unambigous example of evolution to a higher taxaa. OR Name the experiment proving how prokaryotes(asexual) evolved into eukaryotes(sexual)

You dodged my question, evolution is the unifying concept of biology, virtually all biologists agree with this.  Unambiguous example of evolution to a higher taxa...
Check out the therapsids, which clearly and unambiguously show reptile to mammal evolution.

Yes but we agree that evolution is not math based,

No we don't.

Has nothing to do with common design as far as I know.

What does common design predict then, what are similarities in common design based on, why is a bat's wing more similar to my forearm than a bird's wing?  

Because some birds have/had teeth,
duh!


Answer the question, why do the birds that DON'T have teeth, still have the genes for producing teeth?  If they were created distinctly, what is the purpose of having genes to produce structures they will never manifest?  
 


Posts: 1664 | Posted: 3:20 PM on March 20, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Common Design doesn’t apply to everyday life…

Yes it does, common design applies to everything man has makes, atleast 99.999.


The post itself was unlike anything I’d expect from Zerocool, however, after he threw half a thesaurus at me in the debate thread. Zerocool’s temper and ability as a rhetoritician got to me, while his other post made me question if it was even the same person.


A thesaurus is not meant to be thrown.



I really hope you’re not trying to imply that with the tiny amount of animals Noah could have fit on his Ark, that it would then be possible for those animals to expand in number and variety without Natural Selection getting involved.


I didn't bring religion in but some people believe it was a local "world world" flood.


It's not suppose to be as your suggesting.
Given the truly infinite number of possibilities  natural selection could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.

I mentioned this above. WOW, maybe it's a transitional form, so batmen really exist! We don't have fossils because they evolved so quickly in the outskirts of the main population and became extinct, leaving no record.


[/b]That does not answer anything pertaining to my statement.[/b]

Yes it does. The first line. Also when I said God is "reported"lol to have made groups of animals. You didn't respond to me inflected "natural selection and infinit poss" by it's not really needed.

If the evolving populations became extinct, they wouldn’t have have descendants.

Yes the batmen evolved from bats and became extinct.


You are becoming awfully frustrating. I’ll repeat: Stop ignoring the point I keep making about DNA being observed to cause evolution

You just ignored it AGAIN. For the LAST time: WE WATCH DNA CAUSE EVOLUTION. It is not just a matter of noting similarities. I’m talking about the mutation of DNA, not simply its presence in dictating the phenotypic appearance of an organism. In laboratories, where viruses and bacteria are closely scrutinized, we observe pathogens and other microorganisms from one generation to the next, and we see them evolving! After changing some kind of factor in their environment, like the amount of heat they are exposed to, their DNA changes in the cellular reproduction stage of meiosis, and suddenly we have a brand new pathogen swarming over the Petri dish, which is miraculously tolerant to the new factor we changed in their environment. Let’s see if you try to say “Similar organisms have similar DNA,” as a response again.


*yawn* Oh yeah,  the problem is bacteria/virus are obviously adaptable. Bacteria has been around for 3.6 billion years and they basically look the same then as they do now. Are these mutations adding new genes? If so it's probaly not a mutation.
    What's scary is that you think because bacteria/virus adapt to heat means it can turn into 100million species. Sorry, I'm not there.
     It's almost as bad as using an immune system related study to prove evolution. The IM system is suppose to adapt. The IM isn't even mutating or adding new information to DNA.

Precisely.

Evolution is a soft science. Sure, there's math in ID/C too, okay, soft science.


All animals have genes that are off or not selected

That’s not true. The genes are not “off” until an animal finds itself in a tight spot. If the only food laying around was in the form of thick, fibery branches of trees and leaves containing little else than cellulose, a bird wouldn’t sprout teeth and just go to town. Same thing applies to human beings with our appendix. If you chow down on the greens, your appendix isn’t going to suddenly wake up and do something for a change.

If it could be there and it's not, it's off. During reproduction those genes will be present, depending how the gametes match up, it'll be on or off. Genes are "on" or "off" at conception. My statement agrees with your examples, what's all the fuss about.

  Finally, the therasid example is VERY ambigous. Most of the proof is in the jaw bone similarities. Basically "evolving" from 1 bone into 3.
   Mammals are very broad in variety, more so than reptiles(personally). Lions, tigers, bears, whales, bats, flying squirrels, and  there is no account for cold blooded to warm blooded, eggs to placental. Bats and whales have a sonar system. There are no fossils mimicking bats, they were always in the record as is.



(Edited by EntwickelnCollin 3/20/2006 at 8:36 PM).
 


Posts: 96 | Posted: 01:22 AM on March 25, 2006 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

Yes it does. The first line. Also when I said God is "reported"lol to have made groups of animals. You didn't respond to me inflected "natural selection and infinit poss" by it's not really needed.


It’s late, I understand, and I make the same mistakes…. But I didn’t understand hardly any of that.

Oh yeah,  the problem is bacteria/virus are obviously adaptable. Bacteria has been around for 3.6 billion years and they basically look the same then as they do now. Are these mutations adding new genes? If so it's probaly not a mutation.


A mutation of the genetic code includes additions. A mutation of a single nucleotide obviously does not include an addition. Point is, additional genetic material is possible, and it happens all the time. What your idea is in highlighting the difference between additional genetic information and changed genetic information, I’m not so sure. It’s evolution either way.

What's scary is that you think because bacteria/virus adapt to heat means it can turn into 100million species. Sorry, I'm not there.


It doesn’t adapt; it does evolve. The majority of the bacteria that finds itself without the beneficial genes dies off almost immediately. Adaptation is a change made to an organism’s behavior or body without altering anything genetically. Adaptation. If you were to cut your arm off and proceed to have children, your children would be born with both arms. However, if you were to delete the genetic material for your arm, your children would not be born with both arms.

For the bacteria, it’s a matter of dying if you don’t have heat-resistant genes. All the surviving bacteria’s ascendants have heat-resistant genes.

 It's almost as bad as using an immune system related study to prove evolution. The IM system is suppose to adapt. The IM isn't even mutating or adding new information to DNA.


That’s not the case with retro viruses and forms of bacteria like E. Coli. An immune system response is a change in the organism’s body, not their genes, while heat-resistance of bacteria over two generations is a change in the genetic code.

Evolution is a soft science. Sure, there's math in ID/C too, okay, soft science.


ID/C is not science. You know this, or you would have at least attempted to show how you can falsify ID.

If it could be there and it's not, it's off. During reproduction those genes will be present, depending how the gametes match up, it'll be on or off. Genes are "on" or "off" at conception. My statement agrees with your examples, what's all the fuss about.


Our appendix will never turn on unless an additional genetic mutation makes use of it. The gene for teeth in certain species of birds will not turn on without an additional mutation (not seen in the code) that would allow, for example, teeth to grow in a beak. It’s been awhile since this idea was introduced, so let’s get back to the central point of it: ID does not predict vestigial organs, and it does not predict genes that don’t show up in the phenotypic ratio.

Lions, tigers, bears, whales, bats, flying squirrels, and  there is no account for cold blooded to warm blooded


I don’t suspect very accurate accounts may ever be found, either. There are less than a handful of soft tissue samples from fossils tens of millions of years old, due of course to the age of such samples.

Bats and whales have a sonar system. There are no fossils mimicking bats, they were always in the record as is.


It’s better put that they’re hardly in the record at all, as a bat’s anatomy does not allow for very effective fossilization.




-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 02:09 AM on March 25, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Yes it does. The first line. Which says "It's not as you're suggesting" <-- this is the answer to the question.

Also when I said God is "reported" to have made groups of animals. You didn't respond to my inflected "natural selection and infinit poss" but it's not really needed.

INSTANT REPLAY:
Entw: Given the truly infinite number of possibilities  God could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.

Milken: It's not as you're suggesting. It is "reported" lol that God made groups of animals.

Given the truly infinite number of possibilities  Natural Selection could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.END REPLAY

So I was asking you, your question, inflected. First I was making up quotes (ofcourse not) and now I'm making up words.

It’s late, I understand, and I make the same mistakes…. But I didn’t understand hardly any of that.

Yeah, it was sloppy.

A mutation of the genetic code includes additions. A mutation of a single nucleotide obviously does not include an addition. Point is, additional genetic material is possible, and it happens all the time. What your idea is in highlighting the difference between additional genetic information and changed genetic information, I’m not so sure. It’s evolution either way.

 I've been trying to get ahold of some really good mutation information, no luck yet. If it loses genetic information, it's devolution. There's no way something can evolve forward and lose genetic information.
  So a mutated gene, adds information? I thought a copying error may duplicate the same gene sometimes, I guess that my be adding. Recombination isn't adding, but more like shuffling what's available.


However, if you were to delete the genetic material for your arm, your children would not be born with both arms.


Uhh, hopefully my girl has two arms. = ) Sure, they evolved into a different yet very similar bacteria.

For the bacteria, it’s a matter of dying if you don’t have heat-resistant genes. All the surviving bacteria’s ascendants have heat-resistant genes.

It's definitely interesting. The power of bacteria.

ID/C is not science. You know this, or you would have at least attempted to show how you can falsify ID.

They're about the same to me as far as falsifiability. The best falsification of one is to prove the other.

Our appendix will never turn on unless an additional genetic mutation makes use of it. The gene for teeth in certain species of birds will not turn on without an additional mutation (not seen in the code) that would allow, for example, teeth to grow in a beak.

There have been other organs that took awhile for us to figure out but they worked. The appendix is "on" because it's materialized. The teeth aren't there.


ID does not predict vestigial organs, and it does not predict genes that don’t show up in the phenotypic ratio.


As for the appendix, I hate to use the Bible but it says man use to be herbivores, ouch, I know.  Furthermore, ID, not  my knowledge doesn't address these issues. What's the latter?


It’s better put that they’re hardly in the record at all, as a bat’s anatomy does not allow for very effective fossilization.

We know, the record is perfectly flawed to fit the arguement.
 


Posts: 96 | Posted: 04:29 AM on March 26, 2006 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

They're about the same to me as far as falsifiability. The best falsification of one is to prove the other.


Just as disproving one of two known possibilities does not prove the second, proving one does not disprove the second either. It could be a combination of ID and Evolution, it could be one or the other, or it could be none of those two.

As for the appendix, I hate to use the Bible but it says man use to be herbivores, ouch, I know.  


Vegetarians don’t use their appendix. If you were to eat nothing but the cellulose and fiber of green leaves, your appendix still wouldn’t work. God would have had to make the appendix completely useless. I guess you could just come back with the win-all reasoning of “God works in mysterious ways,” or maybe “illogical ways.”

We know, the record is perfectly flawed to fit the arguement.


And? Clearly it’s not just some coincidence; scientists must have made that all up about a bat’s frail anatomy.

Given the truly infinite number of possibilities  Natural Selection could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.


I figured this would come up. Anyway, Natural Selection explains it quite nicely. A mammal with scales would not survive on dry land very well. It would dry out and go extinct, as land-bound organisms with scales likely did. Further, mammals didn’t evolve from fully-developed reptiles, and that’s why you don’t see a crocodile with breasts.

On the other hand, God isn’t limited in any respect. He can mix and match all He wants. He could have given a whale two heads, a twenty-foot-long snake fifty pairs of legs like a reptilian centipede; He could have made enormous insects, a turtle with iron armor on its shell, a lobster with the head of a tiger…

The argument for Common Design centralizes around the idea that the deity likes using designs that work. Well, a tiger head, as the designer would know, is a perfectly fit killing machine that can crunch through bones like twigs. Combined with the body of a lobster, which is also a very good design, God could have created an organism that borrows traits from crustaceans and mammals. Through Natural Selection, that’s impossible, but it’s not through Intelligent Design. And yet we don’t see any kind of experimentation like that at all.



-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 12:36 PM on March 26, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Quote from EntwickelnCollin at 12:36 PM on March 26, 2006 :

Just as disproving one of two known possibilities does not prove the second, proving one does not disprove the second either. It could be a combination of ID and Evolution, it could be one or the other, or it could be none of those two.

Nearly all major players agree there's only two viable options, evolution or creation. If the framework of Creation is proved, evolution is false, period.  


Vegetarians don’t use their appendix. If you were to eat nothing but the cellulose and fiber of green leaves, your appendix still wouldn’t work. God would have had to make the appendix completely useless. I guess you could just come back with the win-all reasoning of “God works in mysterious ways,” or maybe “illogical ways.”

Wrong. As stated, 100 years ago there were organs we didn't know what they did in humans. The vestigal organ list in case you haven't noticed has a trend of getting smaller and smaller. A hundred years ago it was a legitamate topic, now it's not worth bringing up.


And? Clearly it’s not just some coincidence; scientists must have made that all up about a bat’s frail anatomy.

Yeah right, we have bacteria fossils.


I figured this would come up. Anyway, Natural Selection explains it quite nicely. A mammal with scales would not survive on dry land very well. It would dry out and go extinct, as land-bound organisms with scales likely did. Further, mammals didn’t evolve from fully-developed reptiles, and that’s why you don’t see a crocodile with breasts.



The argument for Common Design centralizes around the idea that the deity likes using designs that work. Well, a tiger head, as the designer would know, is a perfectly fit killing machine that can crunch through bones like twigs. Combined with the body of a lobster, which is also a very good design, God could have created an organism that borrows traits from crustaceans and mammals. Through Natural Selection, that’s impossible, but it’s not through Intelligent Design. And yet we don’t see any kind of experimentation like that at all.



   I deleted the 2nd paragraph because it was a waste of space and nonsense. Given a gradual evolutionary method we have thousands of transitionals that are not in the fossil record. In a gradualistic evolution plan, the evolution is so gradual, many mutations would not prevent the animal from surviving. It would take MANY, MANY mutations to give a mammal scales.
   As for the mixed up animal scenario, I'll repeat it again. God is "reported" to have made "kinds". They're not suppose to be mixed up or perfect in every way.
    Truly the last paragraph is what we should see with gradual evolution, survival of the fittest, humans shouldn't just be smart, fast, and strong compared to the rest of the animals, speed and strengh would have been great for survival. We actually lost some physical attributes compared to apes.
 



 


Posts: 96 | Posted: 02:50 AM on March 31, 2006 | IP
RoyLennigan

|        |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 04:29 AM on March 26, 2006 :
Yes it does. The first line. Which says "It's not as you're suggesting" <-- this is the answer to the question.

Also when I said God is "reported" to have made groups of animals. You didn't respond to my inflected "natural selection and infinit poss" but it's not really needed.

INSTANT REPLAY:
Entw: Given the truly infinite number of possibilities  God could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.

Milken: It's not as you're suggesting. It is "reported" lol that God made groups of animals.

Given the truly infinite number of possibilities  Natural Selection could conjure, you’d think we’d see some mammals with scales every once in awhile, or a reptile with mammary glands.END REPLAY

but it doesn't work that way.  god has ultimate power over creation, whereas evolution depends on a direct interaction of the environment with the organism to cause/retain change or to determine if the mutation is useful or not.  god can make any form of animal he wants with no constraints.  change brought about by evolution is limited to the interaction of genes and the environment of the organism.

Quote from Milken at 04:29 AM on March 26, 2006 :I've been trying to get ahold of some really good mutation information, no luck yet. If it loses genetic information, it's devolution. There's no way something can evolve forward and lose genetic information.
  So a mutated gene, adds information? I thought a copying error may duplicate the same gene sometimes, I guess that my be adding. Recombination isn't adding, but more like shuffling what's available.

well seeing as the only information in the first place is varying combinations of the same four base pairs, i don't think any information is really added, ever.  all it is are the interactions of these genes.  a mutation can cause a certain gene pattern that was the same as in the parent, to be just slightly different in the offspring.

the loss of genetic information is not seen as devolution.  sometimes less genetic info is more advantageous.  for instance, with less genes there is less chance for mutation and recombination; so that means that an organism like a fly or a shark that has an extremely stable niche will be better off with less genes, as far as it doesn't hinder the organism's present balanced state.  

also, characteristics based on genes are more of a combined effect; you are the way you are because of how all your genes interact with each other.  in other words, if you changed one base, it could potentially change very many different traits you have (or it could be a gene that is turned off and it would do nothing).  so sometimes a mutation will give an organism an advantage while at the same time disabling them in some other way; such as a human with a larger brain capaicty, but with a weaker jaw.

your statement "more like shuffling what's available" illustrates better what changes in evolution are like.  or with a mutation it could be said to change one tiny piece of a pattern so that it is minutely different, though sometimes with drastic effects.

Quote from Milken at 04:29 AM on March 26, 2006 :They're about the same to me as far as falsifiability. The best falsification of one is to prove the other.

if i were to compare which was closer to being proven on a scale from 0 to 10, i would put the theory of evolution (in its current condition) at 4 and ID/C at 0.7

Quote from Milken at 04:29 AM on March 26, 2006 :There have been other organs that took awhile for us to figure out but they worked. The appendix is "on" because it's materialized. The teeth aren't there.

yes, many of the genes for the appendix are still 'on' because, obviously, it is still there.  but some of the genes for the appendix are 'off' because it serves less of a function than it used to.  its purpose was to metabolize cellulose when humans' primary food source was plant material.  since we eat mostly meat and processed foods, the appendix has little use now.

Quote from Milken at 04:29 AM on March 26, 2006 :As for the appendix, I hate to use the Bible but it says man use to be herbivores, ouch, I know.  Furthermore, ID, not  my knowledge doesn't address these issues. What's the latter?

yes, humans used to be herbivores, though every now and then they would eat some meat.  it wasn't till we started to develop tools that we began to eat large amounts of meat.  as for the latter, the bible doesn't explain a lot of things, its not supposed to explain everything.



 


Posts: 152 | Posted: 11:48 AM on March 31, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Roy is back


but it doesn't work that way.  god has ultimate power over creation, whereas evolution depends on a direct interaction of the environment with the organism to cause/retain change or to determine if the mutation is useful or not.  god can make any form of animal he wants with no constraints.  change brought about by evolution is limited to the interaction of genes and the environment of the organism.


  I agree God has the ability, my point was God didn't use the ability in the way Entw was suggesting. Supposedly he made groups of animals, or kinds as it's called.


well seeing as the only information in the first place is varying combinations of the same four base pairs, i don't think any information is really added, ever.  all it is are the interactions of these genes.  a mutation can cause a certain gene pattern that was the same as in the parent, to be just slightly different in the offspring.


 I understand there are four chemicals involved, all left hand on one side. Ever? I know it's rare but I'd think if Evolution is suppose to work info would get added, atleast in theory.


the loss of genetic information is not seen as devolution.  sometimes less genetic info is more advantageous.  for instance, with less genes there is less chance for mutation and recombination; so that means that an organism like a fly or a shark that has an extremely stable niche will be better off with less genes, as far as it doesn't hinder the organism's present balanced state.  


I know de-evolution isn't a real term.


your statement "more like shuffling what's available" illustrates better what changes in evolution are like.  or with a mutation it could be said to change one tiny piece of a pattern so that it is minutely different, though sometimes with drastic effects.


Recombination is taking advantage of mutations that have already happened.

if i were to compare which was closer to being proven on a scale from 0 to 10, i would put the theory of evolution (in its current condition) at 4 and ID/C at 0.7


Evolution is a great natural explanation, it just doesn't explain enough for me.


yes, humans used to be herbivores, though every now and then they would eat some meat.  it wasn't till we started to develop tools that we began to eat large amounts of meat.  as for the latter, the bible doesn't explain a lot of things, its not supposed to explain everything.


  It's good someone is aware of the herbivore fact and that the Bible isn't suppose to explain everything.



 


Posts: 96 | Posted: 02:11 AM on April 1, 2006 | IP
EntwickelnCollin

|        |       Report Post



Junkie
Post Score
Adjustment:
n/a

Rate this post:

I understand there are four chemicals involved, all left hand on one side. Ever? I know it's rare but I'd think if Evolution is suppose to work info would get added, atleast in theory.


Roy's explanation of additional genetic information was a little confusing for me too. At any rate, I wasn't trying to say that there are any more than four kinds of nucleotides. When you have additional genetic information added, you just have more of the pattern to work with.

  It's good someone is aware of the herbivore fact and that the Bible isn't suppose to explain everything.


Whether or not humans were once herbivores is irrelevant. Our appendix still would not have worked. We have complete vegetarians in our society who don't eat or drink any animal products whatsoever, and yet their appendixes don't work any more than another's.




-------
http://ummcash.org/officers.html
http://scienceblogs.com/pharyngula/2007/08/wow_1.php
http://scienceblogs.com/pharyngula/2007/08/a_triumphant_beginning.php
We're official!
 


Posts: 729 | Posted: 10:40 AM on April 1, 2006 | IP
RoyLennigan

|        |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 02:11 AM on April 1, 2006 :
Roy is back

thanks for the welcome

Quote from Milken at 02:11 AM on April 1, 2006 :I agree God has the ability, my point was God didn't use the ability in the way Entw was suggesting. Supposedly he made groups of animals, or kinds as it's called.

yes, i think this is kind of an endless argument.  we can never know what intention god might have had.  the very nature of a supreme being prevents us from being able to make any assumptions about it.

this is why i like evolution better.  we can view the effects and clues left behind by this process, and so we can make assumptions about it based on our direct experience with the objects and life that it affects.  i'm not an atheist, i just don't think about things that i know can never be determined.

Quote from Milken at 02:11 AM on April 1, 2006 :

well seeing as the only information in the first place is varying combinations of the same four base pairs, i don't think any information is really added, ever.  all it is are the interactions of these genes.  a mutation can cause a certain gene pattern that was the same as in the parent, to be just slightly different in the offspring.


I understand there are four chemicals involved, all left hand on one side. Ever? I know it's rare but I'd think if Evolution is suppose to work info would get added, atleast in theory.

well, i guess it depends on the way you look at it and how you define new information.  all the information is a pattern of these 4 base pairs.  every characteristic is determined by the way in which you arrange these base pairs--any possible way of doing this; the gene pair they are on (1 of 23), the allele of the gene pair they are in(1 of 46), the pattern of other genes around it, the way the patterns are grouped, if the group is turned on or off, maybe even more.

if you want to get an idea of how complex genes are, look at it like this.  in a long chain of base pairs (i.e. something like AGCTCCTAGAGTTCGGAAATCGT) imagine that A=1, G=2, C=3, and T=4.  simple enough, till we start putting them together.  now imagine that A by itself is 1, but when it is next to another letter, A becomes equal to 1 plus half of the value of the letter to the right of it.  imagine it being similar to this for the other letters as well.  now say that we take the average of the entire gene pattern (that long chain of letters above) and add that to each letter.  now if you did this for each gene pattern in each allele and you arrived at a single large number, you could say that this number is the equivalent of the collective features of the organism it belongs to (i actually think that instead of numbers, a more accurate analogy would be equations, but i'll keep it this way for the sake of simplicity).  single genes do not determine single parts of the body, it is the result of the collective interactions of all the genes with each other that create the entire organism as one coherent entity.

Quote from Milken at 02:11 AM on April 1, 2006 :Recombination is taking advantage of mutations that have already happened.

but it can also turn on genes that were not in use in the parent's genome.  there are whole gene patterns that get passed on intact to the offspring, but any small rearrangments in the other genes has the possibility of causing difference, sometimes major change in the organism.  the differences between a son from his father are because of this.  it can still cause "new information" in a similar way that mutations do because it changes the patterns in the genes, which will always cause change.  mutations are more likely to affect minute changes in dna (which are more often benign and useless, but still have the chance to cause drastic change) and recombination through meiosis is more of a large-scale rearranging of patterns in the parents genes.  the difference in the offspring is because of how the change in patterns affect each other; but mutations cause changes in the patterns.

Quote from Milken at 02:11 AM on April 1, 2006 :Evolution is a great natural explanation, it just doesn't explain enough for me.

it doesn't explain enough? what is enough?  personally, i don't set standards on my beliefs, i only believe what i experience.  i don't have a standard view of evolution, but its close enough.  my view is based more on what i have observed myself than what i have read in books.

Quote from Milken at 02:11 AM on April 1, 2006 :It's good someone is aware of the herbivore fact and that the Bible isn't suppose to explain everything.

heh, well they're both common sense to me.


 


Posts: 152 | Posted: 3:48 PM on April 1, 2006 | IP
RoyLennigan

|        |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from EntwickelnCollin at 10:40 AM on April 1, 2006 :
I understand there are four chemicals involved, all left hand on one side. Ever? I know it's rare but I'd think if Evolution is suppose to work info would get added, atleast in theory.


Roy's explanation of additional genetic information was a little confusing for me too. At any rate, I wasn't trying to say that there are any more than four kinds of nucleotides. When you have additional genetic information added, you just have more of the pattern to work with.

heh, sorry about the confusion, i'm not always good at converting my thoughts to coherent words.  yes, more genes means more variables upon which overall characteristics are dependant.

Quote from EntwickelnCollin at 10:40 AM on April 1, 2006 :
  It's good someone is aware of the herbivore fact and that the Bible isn't suppose to explain everything.


Whether or not humans were once herbivores is irrelevant. Our appendix still would not have worked. We have complete vegetarians in our society who don't eat or drink any animal products whatsoever, and yet their appendixes don't work any more than another's.

well, im going to have to disagree with you here.  our appendix would have served its purpose in our ancient ancestors.  this would have been on the order of hundreds of thousands of years ago, though.  the appendix digests the hard cellulose in unprocessed leafy plant material.  modern vegitarians hardly eat any of the kind of plant material that our ancient ancestors had to eats.  its like the difference between what a vegan eats and what a gorilla eats.  the reason why the appendixes of vegitarians doesn't work is because some of the genes for its function arent turned on anymore.  genetically, it doesn't work for anyone because there hasn't been a need for it to.  somewhere along the line, all our ancestor's genes got mixed with the dominant genes of someone with a non-working appendix.


 


Posts: 152 | Posted: 3:57 PM on April 1, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I'm back after almost a month of continuous travel.   Whew!, glad to be home. :-)

Quote from Milken at 05:15 AM on March 18, 2006 :
Thank you for proving and missing the point.


Oh yeah?


Lotka article
These models are computationally intensive, and don't necessarily illuminate the system dynamics.

They do to people who understand mathematics.


Tamura article
But it is possible - Felsenstein defines a maximum likelihood method that searches for a MLE estimate of the phylogenetic distance between two sequences with mutation rates estimated from the actual sequences.

Assumes they descended from common ancestors.

Therefore if the assumption was wrong, the math wouldn't work.  I've got news for you, the math works.


Jukes - Cantor Correction
Assumes they descended from common ancestors. Almsot not relevant

Again, if the assumption was wrong, the math wouldn't work.   A good start towards mathematically disproving common descent would be to show that this math is wrong, why don't you get started?


Fokker-Planck (interesting name)

Computer Based Simulaton, seriously, as if the simulation is indicative of real life. CBS is the cornerstone of fact free sciecne.


You'll be interested to know the next time that you fly that the wings on your plane were designed with these  "fact free science" equations.  Mathematics is remarkable in the way that it describes actual physical relationships in the real world.


I'm finished with this. I refuse to waste the time. A science that uses math is not a math based science, there is a difference.


Giving up eh?  I'm not surprised that you gave up before Hardy-Weinberg.


Thank you for showing me all the mathematical generalizations, once again you all are disagreeing with other Eist on this one.


Where?



(Edited by Apoapsis 4/11/2006 at 11:56 AM).


-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 09:00 AM on April 11, 2006 | IP
Milken

|     |       Report Post



Member
Post Score
Adjustment:
n/a

Rate this post:

Quote from Apoapsis at 09:00 AM on April 11, 2006 :
I'm back after almost a month of continuous travel.   Whew!, glad to be home. :-)



They do to people who understand mathematics.


Such a statement is better applied to someone else.
1) this is so old I barely remember and I'm surprised I'm responding

2) The is not whether there's math in evolutionary studies but whether  we have any  to prove the theory of evolution completely.


Tamura article
But it is possible - Felsenstein defines a maximum likelihood method that searches for a MLE estimate of the phylogenetic distance between two sequences with mutation rates estimated from the actual sequences.

Assumes they descended from common ancestors.


Therefore if the assumption was wrong, the math wouldn't work.  I've got news for you, the math works.


  You missed it. Please, think this one out carefully.

1) I heard a noise so I know there's a monster under my bed
2) I have a can of "monster spray" that eradicates mosnters under the bed
3) I spray the can and the moster's gone
4) The "monster spray" works!

The monster spray(Tamura) works in this scenario assuming there really is a monster( common descent) under the bed.

Tamura's assumption is common descent(monster under the bed), if common descent is not true, the math (monster spray) doesn't mean anything. I hope this is clear





Jukes - Cantor Correction
Assumes they descended from common ancestors. Almsot not relevant


Again, if the assumption was wrong, the math wouldn't work.   A good start towards mathematically disproving common descent would be to show that this math is wrong, why don't you get started?


See previous post



Fokker-Planck (interesting name)

Computer Based Simulaton, seriously, as if the simulation is indicative of real life. CBS is the cornerstone of fact free sciecne.


You'll be interested to know the next time that you fly that the wings on your plane were designed with these  "fact free science" equations.  Mathematics is remarkable in the way that it describes actual physical relationships in the real world.


Explain Fokker-Plank and how it proves evolution. . . .



I'm finished with this. I refuse to waste the time. A science that uses math is not a math based science, there is a difference.


Giving up eh?  I'm not surprised that you gave up before Hardy-Weinberg.


Thank you for showing me all the mathematical generalizations, once again you all are disagreeing with other Eist on this one.


Where?

Hardy-Weinberg is a math equation and NOT A BIOLOGICAL LAW - Ernst Mayr
PEACE!




(Edited by Apoapsis 4/11/2006 at 11:56 AM).




 


Posts: 96 | Posted: 04:06 AM on April 20, 2006 |
IP
tanzanos

|      |       Report Post




Newbie
Post Score
Adjustment:
n/a

Rate this post:

Please let us get serious for a change. Creationists should consider one thing: All science is related. Biology, Chemistry, Geology etc. They all have to follow the laws of physics. Yes life can come from non life because life is made up of non life (chemical compounds).  If you the creationsists want to live in a world where everyone believed in creationism then rest assured it will be a world without any of the amenities offered by science (no electronics, phones, Tv, Medicine, surgery, weather forecast,) the list is endless. Your world would be one very similar to the dark ages. Women would be burned at the stake simply because they owned a black cat. Finally, Biology makes NO SENSE without EVOLUTION. Also try telling NASA that their physics is all wrong, and that millions of scientists worldwide are dead wrong and that ONE single page in a book written at a time when most humans believed the world was flat, is the only proof of our origins.


-------
Mighty is the Sword that Draws Blood,
Mightier is the Pen that Draws Ink,
Mightiest is the Tongue that Draws Ears.
 


Posts: 2 | Posted: 12:12 PM on April 20, 2006 | IP
EMyers

|     |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I'm still trying to find the black cat reference in my Bible.  Where are you finding it?


-------
"Thou believest that God is one; thou does well: the demons also believe, and shudder." James 2:19 - Belief is never enough.
 


Posts: 1287 | Posted: 1:38 PM on April 20, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from EMyers at 1:38 PM on April 20, 2006 :
I'm still trying to find the black cat reference in my Bible.  Where are you finding it?


I don't believe he said that black cats were in the Bible, he said that in the middle ages women were killed for having black cats, which is quite true.  They were killed for having any cats at all in many cases, cats being considered a symbol of witchcraft by the Inquisition.




-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 3:30 PM on April 20, 2006 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Milken at 04:06 AM on April 20, 2006 :

Such a statement is better applied to someone else.
1) this is so old I barely remember and I'm surprised I'm responding


I was in the Arctic, a long way from a road let alone an Internet connection.

2) The is not whether there's math in evolutionary studies but whether  we have any  to prove the theory of evolution completely.


Sorry, but that's not what you asked for:

Quote from Milken at 3:23 PM on March 3, 2006 :
Name all the math based theories of Evolution, please and match those up with the math based theories of chemistry.


Quote from Milken at 02:09 AM on March 9, 2006 :
Name the math theorms supporting Evolution.





-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1747 | Posted: 3:59 PM on April 20, 2006 | IP
    
Multiple pages for this topic [ 1 2 ]

Topic Jump
« Back | Next »
Multiple pages for this topic [ 1 2 ]
Forum moderated by: admin
    

Topic options: Lock topic | Unlock topic | Make Topic Sticky | Remove Sticky | Delete thread | Move thread | Merge thread

 

© YouDebate.com
Powered by:
ScareCrow version 2.12
© 2001 Jonathan Bravata. All rights reserved.