PRO

Political & Fun Debates Forum with Polls

CON

Harvard Business Review Magazine People Magazine Gift Subscription

YouDebate.com Forum
» back to YouDebate.com
Register | Profile | Log In | Lost Password | Active Users | Help | Board Rules | Search | FAQ |
Custom Search
» You are not logged in.   log in | register

  YouDebate.com Forum
   Creationism vs Evolution Debates
     amino acids = life?

Topic Jump
« Back | Next »
Multiple pages for this topic [ 1 2 3 4 5 ]
Forum moderated by: admin
    

    
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from catstye cam at 04:23 AM on July 26, 2010 :


I don't think Sir Fred Hoyle thought much to your 'compelling evidence'...


And?

Hoyle was a cosmologist and committed anti-Darwinist.  He once tried to "prove" that one of the 8 fossil specimens of Archaeopteryx was a fake, for some reason, and went so far as to team up with a YEC (Lee Spetner) to publish a paper on it.  So convincing was their result that it ended up making it into print is a British photography magazine.  
They apparently didn't think to test the other 7 specimens.

Hoyle also felt that Haldane's dilemma is an illusion - do you agree with that as well?


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 11:40 AM on July 27, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 07:55 AM on July 26, 2010 :

You seem to have a fundamental misunderstanding of genetics.


Say - didn't you once claim that DNA was made of amino acids?


'Survival of the fittest' is the spin doctor's version of 'extinction of the least fit'. Natural selection weeds out inferior genes, it never creates anything.


So I see that you need a primer on what evolution actually entails.



-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 11:44 AM on July 27, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 05:49 AM on July 27, 2010 :
Quote from Lester10 at 04:45 AM on July 25, 2010 :

Pasteur showed spontaneous generation to be impossible.
Derwood
No, he showed that bacteria and yeast and such to not emerge from sterile media.


In other words, life does not come from non-life, or spontaneous generation does not happen.


The spontaneous generation of bacteria, mice, and yeast, sure.  Who ever said this would happen?


Lester10
Miller experimented with generating life by 'natural processes' for 50 years or so. It never happened - not even close.
Derwood
Pleas eprovide a SINGLE valid citation from Miller demonstrating that he sought to 'generate life.'


What do you imagine he was busy doing?


A simple "I can't, I am just parrotting what my YEC handlers tell me to think" would have done.

Tell me - have you ever actually looked into what he did?  Or do you just trust your YEC sources?  Because if you actually looked into it yourself, you apparently did not learn anything, and we hyave shown repeatedly on this forum that trusting YECs/IDs with websites of vanity press books makes you look like a fool.


Derwood
I would think that if all the facts and the TROOOF are on your sid,e you would not feel the need to misrepresent, distort, and lie about these things.


Precisely, which is why I don’t need to.

So, elephants really do have bone-to-bone connections between their limbs and their axial skeleton?  I mean, according to Menton, they must!



-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 11:48 AM on July 27, 2010 | IP
catstye cam

|     |       Report Post




Junior Member
Post Score
Adjustment:
n/a

Rate this post:

Gaunt wrote...
The Koran's writing are no more 'proof' of God than Tolkien's writings are proof of Dragons and talking trees.


You've muddled up your analogy.
Tolkien never claimed to be more than a human being and I'm sure that none of his readers have ever thought that he was more than that when they read his books.

As for the Qur'an, its Author claims to be the eternal Creator and Sustainer of everything that exists and has existed.
And I can tell you, that  the more I read that book, and the more I try to live by its teachings and wisdom, the more convinced I become that its Author is exactly who He says He is.

 


Posts: 28 | Posted: 11:51 PM on July 27, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I AM GOD. STOP WORSHIPING THE QUR'AN OR I'M GOING TO BE VERY MAD.


-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 12:38 AM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Sorry. Dunno what happened.


-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 12:39 AM on July 28, 2010 | IP
catstye cam

|     |       Report Post




Junior Member
Post Score
Adjustment:
n/a

Rate this post:

I hope you're alright now, Wisp.

I don't actually worship the Qur'an, I worship its Author, whose name is Allah...but I refer to Him as 'God' when talking to non-Muslims.
This is to avoid confusion, particularly as I believe Him to be the same One worshipped by Jesus, Moses, Abraham, and the Prophets of the Old Testament
 


Posts: 28 | Posted: 01:00 AM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

I understand that. I do pretty much the same thing when i say "God". I mean the infinite and absolute sum of every 'friggin thing, which i think your petty gods point to.

Brahman and Tao are much cooler than any abrahamic version, in my opinion.



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 01:03 AM on July 28, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Derwood
Say - didn't you once claim that DNA was made of amino acids?


Sounds more like something you would say.

Lester
'Survival of the fittest' is the spin doctor's version of 'extinction of the least fit'. Natural selection weeds out inferior genes, it never creates anything.
Derwood
So I see that you need a primer on what evolution actually entails.


Or maybe you do. What do you say natural selection does?



-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 01:21 AM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Amazing...


-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 01:35 AM on July 28, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Wisp
Amazing...


I know - who would have thought that Derwood wouldn't even know what natural selection is.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 02:15 AM on July 28, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from catstye cam at 5:51 PM on July 27, 2010 :
You've muddled up your analogy.
Tolkien never claimed to be more than a human being and I'm sure that none of his readers have ever thought that he was more than that when they read his books.


No, the analogy is more than apt. I dont care what he 'claimed' to be, that has nothing to do with the issue. The fact is that the koran is as much of a 'proof' for the existence of God as Tolkien is for the existence of Ents. Its a book, uncited, contradictory, nothing more. There is no 'proof' there, there is no 'evidence' there.

As for the Qur'an, its Author claims to be the eternal Creator and Sustainer of everything that exists and has existed.


Yes well...

And I can tell you, that  the more I read that book, and the more I try to live by its teachings and wisdom, the more convinced I become that its Author is exactly who He says He is.


Good for you. But be aware that is your personal choice based on NO actual evidence whatsoever. Now, to be fair, there is nothing wrong with that I suppose (depending on which parts of the koran you take to be the unshakable truth: the ones that advocating murder of non-believers and beating your wife with a cane are problematic). Faith doesnt require evidence or proof, thats why its called faith.

If you come on this forum and tell me that you believe, regardless of the evidence, that there is a god because of your personal faith, I will say congratulations. You can't disprove faith, after all.

Its when people come here and try and declare they have 'scientific evidence' for their religious beliefs, or claim that practical, scientific inquiry supports it, that I poke giant logical holes in them, because thats just foolish.

You believe? OK. I have no answer to that, but dont pretend your beliefs are in any way supported by practical science, and dont try to get your beliefs taught in science class.





-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 02:22 AM on July 28, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Gaunt to catstye Cam
Good for you. But be aware that is your personal choice based on NO actual evidence whatsoever.


Information only ever comes from intelligence. DNA is chock full of information that does not arise by any known physical law. So there is evidence after all. Evidence for intelligent information and evidence against natural law.

Who God is is another argument - a theological one. I believe it is the God of Abraham, Isaac and Jacob but I can't do any experiments to demonstrate that. So lets just stick with the argument for intelligent design.

Faith doesnt require evidence or proof, thats why its called faith.


It depends, does it matter whether it is an intelligent faith or not? I think it does. If any faith will do, then go for any old religious belief and it doesn't matter which one. I think that's dumb.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 03:04 AM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester
Information only ever comes from intelligence.
The defining game again.

OK, then there's no information in the DNA.

DNA is chock full of information that does not arise by any known physical law. So there is evidence after all.
Superb!

Measure it here, please:
CTGTCTCTGCCGCAAATGCAGCACCTTCCTCAGTCTTGGGGCGTCCATCAAGCGGAGAGC
TGGAATGTGACTGAAAGTAACAGAGTATAGGTGGAACTAGAACAAGGTCACGAGCTGGTG



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 03:12 AM on July 28, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 9:04 PM on July 27, 2010 :
Information only ever comes from intelligence. DNA is chock full of information that does not arise by any known physical law. So there is evidence after all.


Only someone with your special combination of ignorance and arrogance would claim that their opinion is 'evidence' supporting their opinion.

You WANT to believe that information only arises from intelligence, but that is nothing more than your unsubstantiated opinion, and an opinion, by the way, for which there is an enormous amount of contrary evidence.

Amino acid chains arising from inorganic chemicals is a perfect example of you being wrong. Creation of complex crystal mathematical patterns in nature is another. In fact there are innumerable examples all around you of highly organised, incredibly complex information-bearing elements that arise from less complicated antecedants naturally. So you are, as usual, factually wrong.

The funny thing is, you being factually wrong wasnt even the hilarious part of your post: the best part was the glimpse into the limited psyche of lester: "here is my opinion, which I believe to be true, and therefore it is evidence for another one of my opinions."

Do you even know what the words 'evidence' and 'proof' actually mean?


Who God is is another argument - a theological one. I believe it is the God of Abraham, Isaac and Jacob but I can't do any experiments to demonstrate that. So lets just stick with the argument for intelligent design.


Sorry, not even close. If you wish to present evuidence of divine origin, regardless of which of the 50,000 human divinities from past and present it is, you need to provide EVIDENCE of that. YOU are the one who keeps saying that, if it cant be proven in a lab its imaginary (which is crap, but it IS your claim, so either you stick by it, or admit it is crap).

So, please present a single shred, just one iota, or positive, reproducable evidence for creationism. I DARE you.

(Now, watch lester squirm away like a coward without answering!)

Faith doesnt require evidence or proof, thats why its called faith.


It depends, does it matter whether it is an intelligent faith or not? I think it does. If any faith will do, then go for any old religious belief and it doesn't matter which one. I think that's dumb.


What is an 'intelligent faith' lester? is that just made-up lester-speak for trying to create an artificial and imaginary divide between your faith and the faith of others?

Is that just the arrogance of Lester trying to claim that HIS faith is somehow different from the faiths of the Inuit, or the ancient sumerians, or the scientologists?

You are the last person in the world to talk about intelligent faith lester, you have already revealed that you dont even know the basics of your own theology and religious history, and had to be educated by me (from which, of course, you fled like a coward...)




(Edited by Gaunt 7/28/2010 at 06:46 AM).


-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 03:43 AM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Gaunt
Lester
Who God is is another argument - a theological one. I believe it is the God of Abraham, Isaac and Jacob but I can't do any experiments to demonstrate that. So lets just stick with the argument for intelligent design.
Sorry, not even close. If you wish to present evuidence of divine origin, regardless of which of the 50,000 human dibinities from past and present it is, you need to provide EVIDENCE of that.
Besides it DOES matter what divinity we're talking about whenever Lester accuses us of being "naturalists".

Like when we demonstrate that the Earth is billions of years old. He thinks that's natualism, but why would that be, if not because of HIS particular belief in HIS chosen deity? Because not every deity conflicts with the same facts as Yahweh does.





So Lester... Intelligent faith, huh? How is that witch hunt in Africa? How many children witches have you valiantly slain?



Look how deceptive those witches are!


Go get 'em, tiger!



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 04:28 AM on July 28, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

LesterDNA is chock full of information that does not arise by any known physical law. So there is evidence after all.
Wisp
Superb!

Measure it here, please:
CTGTCTCTGCCGCAAATGCAGCACCTTCCTCAGTCTTGGGGCGTCCATCAAGCGGAGAGC
TGGAATGTGACTGAAAGTAACAGAGTATAGGTGGAACTAGAACAAGGTCACGAGCTGGTG


You don't need to measure it to determine that it has purpose Wisp. We've been over this before.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 07:09 AM on July 28, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Gaunt
(Now, watch lester squirm away like a coward without answering!)


Thank you, thank you... yes, I was right again: but then, to be fair, predicting that Lester will be a shameful coward and flee from any challenge, evidence or question is a bit like predicting the sun will rise in the east.




-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 07:19 AM on July 28, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Why don't you try saying something worth reading for a change Gaunt?


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 07:25 AM on July 28, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 01:25 AM on July 28, 2010 :
Why don't you try saying something worth reading for a change Gaunt?



LOL!

I do lester, ever post, and yet every single time, you squirm and wiggle away from it like a coward.

You tried this tactic yesterday you silly adolescent, pretending that I somehow dont present substance: so I did you the kindness of summing up just a couple of the many reasonable substantive questions I keep asking you all the time, and you squirm away from like a coward, every time.

And when I neatly presented them all for you to answer in one place, showing just what happens when I give you questions of substance, what did you do?

Thats right, you ignored them and fled like a coward, as always, as predicted.


In fact, the very thing that caused me to write the post you are responding to was more direct questions to you Lester, more direct evidential challenges of your claims lester, each of which you fled from like a coward.


I give you plenty of stuff worthy of reading and answer, you are just too shameful and terrified to addrerss them and admit you have no answers. Dont blame me for your own deficiencies.


-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 07:41 AM on July 28, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 01:21 AM on July 28, 2010 :
Derwood
Say - didn't you once claim that DNA was made of amino acids?


Sounds more like something you would say.

Right, because I have also claimed that phenotype ONLY deals with outward morphology, didn't I?


Lester
'Survival of the fittest' is the spin doctor's version of 'extinction of the least fit'. Natural selection weeds out inferior genes, it never creates anything.
Derwood
So I see that you need a primer on what evolution actually entails.


Or maybe you do. What do you say natural selection does?

Why did you think I was not referring to your depiction of 'survival of the fitest'?  Because, you see, I was.  



-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 11:35 AM on July 28, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 03:04 AM on July 28, 2010 :

Information only ever comes from intelligence.



The usual YEC/ID assertion supported only by silly analogies.


-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 11:39 AM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester
LesterDNA is chock full of information that does not arise by any known physical law. So there is evidence after all.
Superb!

Measure it here, please:
CTGTCTCTGCCGCAAATGCAGCACCTTCCTCAGTCTTGGGGCGTCCATCAAGCGGAGAGC
TGGAATGTGACTGAAAGTAACAGAGTATAGGTGGAACTAGAACAAGGTCACGAGCTGGTG
You don't need to measure it to determine that it has purpose Wisp.
I didn't ask if it had a purpose. You said DNA is chock full of information, so i ask you to demonstrate it by measuring it in a chunk of coding DNA. So now you retreat to "it has a purpose".

How can you know how full of information it is if you can't measure it?



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 11:40 AM on July 28, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 07:09 AM on July 28, 2010 :
LesterDNA is chock full of information that does not arise by any known physical law. So there is evidence after all.
Wisp
Superb!

Measure it here, please:
CTGTCTCTGCCGCAAATGCAGCACCTTCCTCAGTCTTGGGGCGTCCATCAAGCGGAGAGC
TGGAATGTGACTGAAAGTAACAGAGTATAGGTGGAACTAGAACAAGGTCACGAGCTGGTG


You don't need to measure it to determine that it has purpose Wisp. We've been over this before.

You need to be able to measure it to determine how much information there is (you keep claiming DNA is 'information rich' - how do you know?) and to determine when an increase or decrease has occurred.

By the way - what is the 'purpose' of the DNA sequence wisp presented?  You imply that you know...




-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 11:43 AM on July 28, 2010 | IP
catstye cam

|     |       Report Post




Junior Member
Post Score
Adjustment:
n/a

Rate this post:

Gaunt wrote....
You believe? OK. I have no answer to that, but dont pretend your beliefs are in any way supported by practical science, and dont try to get your beliefs taught in science class.


Although various natural phenomena are mentioned in the Qur'an, it is not a science book, and I don't think it should be used as such in a science class.
Children need to be taught   to look at the world around them and think about it.
They should learn how to test their ideas  and form conclusions from the results.
If they can't do the testing themselves, then they should watch the teacher doing it or learn about how it was done by someone else.

There is no point in telling them that 'this happens' or 'that happens', they have to understand how.

 


Posts: 28 | Posted: 12:43 PM on July 28, 2010 | IP
porkchop

|     |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from wisp at 11:40 AM on July 28, 2010 :
Lester
LesterDNA is chock full of information that does not arise by any known physical law. So there is evidence after all.
Superb!

Measure it here, please:
CTGTCTCTGCCGCAAATGCAGCACCTTCCTCAGTCTTGGGGCGTCCATCAAGCGGAGAGC
TGGAATGTGACTGAAAGTAACAGAGTATAGGTGGAACTAGAACAAGGTCACGAGCTGGTG
You don't need to measure it to determine that it has purpose Wisp.
I didn't ask if it had a purpose. You said DNA is chock full of information, so i ask you to demonstrate it by measuring it in a chunk of coding DNA. So now you retreat to "it has a purpose".

How can you know how full of information it is if you can't measure it?



Wisp, about that last book you read.... Were you able to measure it's information? If so, how?



-------

Our knowledge on the process is increasing, and will increase. And yet we can't know for sure every small step on the way. -Wisp.................
What? Are biologists lacking knowledge for mutation experiments to turn one type of animal into another? This is a small step? ?
 


Posts: 298 | Posted: 8:47 PM on July 28, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Wisp, about that last book you read...
Yes?
Were you able to measure it's information?
I would if i wanted to.
If so, how?
I would transcribe it, save it, and check the properties of the file.



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 10:05 PM on July 28, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Porkchop
Wisp, about that last book you read.... Were you able to measure it's information? If so, how?
Wisp
I would transcribe it, save it, and check the properties of the file.


And if you weren't sure how to do that? Would it mean that the book had no information?






-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 02:06 AM on July 29, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

No, silly!

I would just count the letters, signs and spaces, and calculate.

D'oh!



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 02:20 AM on July 29, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Porkchop
Wisp, about that last book you read.... Were you able to measure it's information? If so, how


Since Lester was (as predicted, as always) too shameful a coward to deal with the factual rebuttals and logical challenges presented to his silly claims above, perhaps porkchop can do a bit better...


The assertion that 'information can only come from intelligence' is factually false.

Nature is replete with complicated, information-bearing structures, arising from simpler, less complex antecedants, all arising naturally.

The incredible complexity of the snowflake, or the geode or any other crystalline structure arising from vastly less complex structures or compounds naturally is probably the most obvious example, but there are thousands of others. nature is filled with examples of 'information' arising naturally and spontaniously in all sorts of different structures.

So lester claiming (and then fleeing like a coward from, as soon as it was challenged) that 'information' can ONLY come from intelligence is just flat-out wrong, nor does he make any effort (again, unsurprisingly) to justify or evidence that silly claim.

Thats fine, we are all used to Lester's cowardice and dishonest absurdities, they are entertaining. But you, porkchop, seem to be continuing along with his assertion. If I am wrong, and you reject it, please correct me. But if not, and you are swallowing his assertions, can you explain how you rationalise the fact that they are, as just shown, completely at odds with reality?

(Edited by Gaunt 7/29/2010 at 05:18 AM).


-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 05:16 AM on July 29, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from porkchop at 8:47 PM on July 28, 2010 :


Wisp, about that last book you read.... Were you able to measure it's information? If so, how?



Has wisp been the one running around making proclamations regarding 'information'?

Or was that someone else?



-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 07:32 AM on July 29, 2010 | IP
derwood

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 02:06 AM on July 29, 2010 :
Porkchop
Wisp, about that last book you read.... Were you able to measure it's information? If so, how?
Wisp
I would transcribe it, save it, and check the properties of the file.


And if you weren't sure how to do that? Would it mean that the book had no information?







This back and forth is all very well if it dealt solely with esoteric musings.

However, the YEC/ID crowd uses their 'information' claims as some sort of evidence in their firght to replace a valid scientific theory with their religious fantasies.  So it will not do to try to shift the burden - WE are not the ones claiming that information must come from an intelligence; WE are not the ones claiming that natural means cannot increase information.

YOU are.  

Why is it thyat YEC/IDists are IMPOTENT when it comes to actually supportijng their own claims, and seem capable ONLY of erecting strawmen and engaging in all manner of logically fallacious argumentation?

Oh - and when are you going to explain what magic force allows elephants and bears and tigers to walk on land, seeing as how their weight-bearing forelimbs do not actually attach to the rest of their skeletons, as a YEC anatomist claimed and you steadfastly agree with?




-------
Lester:

"I said I have a doctorate and a university background in anatomy, physiology, biochemistry, physics, chemistry, pathology etc. ..."
 


Posts: 1355 | Posted: 07:37 AM on July 29, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Derwood
Has wisp been the one running around making proclamations regarding 'information'?

Or was that someone else?


I stick by my proclamations regarding information. Information has purpose. It can't arrange itself.




-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 12:53 PM on July 29, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 06:53 AM on July 29, 2010 :
I stick by my proclamations


Of course you do. You would have to be capable of rational thought to do otherwise, and after all, you never admit error even when you are flat-out, unquestionably proven wrong, mr Doctors-never-study-evolution-in-medical-school.


Information has purpose. It can't arrange itself.


You are just throwing out words at random and then redefining them to suit your purpose, and it makes you look silly.

I have already provided a half dozen examples of naturally occurring 'infomation', arising from less complex sources, which have no 'purpose' at all. But, I suppose since you were too coardly to aknowledge or respond to them, you then just pretended they were never said, as usual. How amusingly predictable.

Claiming information has purpose is just another factually incorrect vaguely clever-sounding massive overgeneralization (remember when you accused me of doing that? LOL!) that means little.


tell me Lester, why do you even come to a debate board if you refuse to engage in debate, and you flee like a coward every time anyone proves you wrong? Is being embarassed in public some kind of bizarre self-flagellating kick for you?


Tell me something.

3 x 7 = 21.
What is the 'purpose' of that information exactly? Did God make three times seven equal 21? Can he make it equal 23 if he wants?



-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 1:14 PM on July 29, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester
Derwood
Has wisp been the one running around making proclamations regarding 'information'?

Or was that someone else?
I stick by my proclamations regarding information.
You stick by your unsupported silly claims... What a shock...
Information has purpose.
How do you know?

Demonstrate your knowledge and understanding.

C
T
G
T
C
T
C
T
G
C
C
G
C
A
A
A
T
G
C
A
G
C
A
C
C
T
T
C
C
T
C
A
G
T
C
T
T
G
G
G
G
C
G
T
C
C
A
T
C
A
A
G
C
G
G
A
G
A
G
C
T
G
G
A
A
T
G
T
G
A
C
T
G
A
A
A
G
T
A
A
C
A
G
A
G
T
A
T
A
G
G
T
G
G
A
A
C
T
A
G
A
A
C
A
A
G
G
T
C
A
C
G
A
G
C
T
G
G
T
G

It can't arrange itself.
Can you distinguish a segment of coding DNA from one that has been made up by me?

Oh... That would have the purpose of making you look like a fool again... OK, can you distinguish it from a randomized sequence?


(Edited by wisp 7/29/2010 at 2:22 PM).


-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 2:17 PM on July 29, 2010 | IP
porkchop

|     |       Report Post




Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Gaunt at 05:16 AM on July 29, 2010 :
The incredible complexity of the snowflake, ...


complexity of a snowflake? They are just simple structures that are dictated by the laws of nature. There is no coding involved,you cannot make this distinction?




-------

Our knowledge on the process is increasing, and will increase. And yet we can't know for sure every small step on the way. -Wisp.................
What? Are biologists lacking knowledge for mutation experiments to turn one type of animal into another? This is a small step? ?
 


Posts: 298 | Posted: 9:11 PM on July 29, 2010 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from porkchop at 9:11 PM on July 29, 2010 :
Quote from Gaunt at 05:16 AM on July 29, 2010 :
The incredible complexity of the snowflake, ...


complexity of a snowflake? They are just simple structures that are dictated by the laws of nature. There is no coding involved,you cannot make this distinction?


A snowflake condenses from a random cloud of vapor!  How can such order develop from disorder without outside intelligence.



-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1348 | Posted: 12:36 AM on July 30, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Every step in the life cycle of a snowflake obeys 2LOT.
Heat is neither created nor destroyed.
Heat flows from a hot place to a cold place.Heat becomes less well organized because it is more evenly distributed through the universe as cold places heat up and warm places cool down.
Snowflakes don't violate any natural laws.
Mineral crystals form for the same reasons snow crystals form. Heat is released as snowflakes form and thus entropy increases in accordance with 2LOT.

Formation of DNA and life is against the laws of nature so they could not have happened naturally. It takes organization overriding the laws of nature to form DNA and life.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 01:41 AM on July 30, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester
Every step in the life cycle of a snowflake obeys 2LOT.
D'oh!

Of course. Everything does. Always. And that has absolutely no relevance, since you will never demonstrate that Evolution is any different.

Formation of DNA and life is against the laws of nature so they could not have happened naturally. It takes organization overriding the laws of nature to form DNA and life.
Kinda tautological, isn't it?

Do you think that vain repetition will get you closer to be believed?



-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 01:49 AM on July 30, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from porkchop at 3:11 PM on July 29, 2010 :
complexity of a snowflake? They are just simple structures that are dictated by the laws of nature. There is no coding involved,you cannot make this distinction?


Actually Porkchop, snowflakes are incredibly complicated and mathematically precise structures that arise through the laws of nature. They are packed full of information: geometric laws, mathematical formulae, and they arise from a far, far simpler substance through a simple process.

They are ordered, they are precise, they are each unique and they mind-bafflingly complicated: and they arise from complete randomness and disorder through a natural process, something Lester keeps telling us is completely impossible.

No coding, you say? I say the difference between a simple drop of H2O and the infinitely complicated near-fractal, well ordered patterns of a snowflake or ice crystal are as different in complexity as alphabet soup is to the works of shakespeare.

And yet you and Lester keep saying that 'information must come from intelligence', and that 'incredibly complicated systems cannot just form out of far simpler ones naturally'.

So it seems you deny the existence of snowflakes, or rather you believe they must be impossible, so every one must have been handcrafted by your God. Either that, or you are flat-out wrong...




(Edited by Gaunt 7/30/2010 at 03:23 AM).


-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 02:50 AM on July 30, 2010 | IP
Gaunt

|     |       Report Post



Regular
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 7:41 PM on July 29, 2010 :
Every step in the life cycle of a snowflake obeys 2LOT.


Yes it does. Crikey lester, I think thats the first non-made-up, based-in-reality fact I have seen you post in weeks. I would be remiss if I did not congratulate you on your unusual accuracy.

Of course, every step in the evolutionary cycle also obeys the Second law of thermodynamics. Your silly, unevidenced inventions to the contrary are bafflingly without foundation.

Heat is neither created nor destroyed.
Heat flows from a hot place to a cold place.


Thank you for showing us yet again that you do not even have a grade 9 understanding of basic physics. Your above sentences dont make the SLIGHTEST sense.

Heat cannot be 'created or destroyed', heat is an effect, not a cause. heat can be added or removed, and in the case of a snowflake (not in a closed system), heat is removed from the water droplet. Since neither the snowflake or evolution take place in a closed system, neither has ANY implications on the second law of thermodynamics.


And to cut off your usual made up fairy tales about the 'universe being a closed system', allow me to quote you from a grade 10 physics textbook, which you yourself will study when you get old enough:

Isolated systems are completely isolated in every way from their environment. They do not exchange heat, work or matter with their environment. An example of an isolated system would be a completely insulated rigid container, such as a completely insulated gas cylinder.
Closed systems are able to exchange energy (heat and work) but not matter with their environment. A greenhouse is an example of a closed system exchanging heat but not work with its environment. Whether a system exchanges heat, work or both is usually thought of as a property of its boundary.
Open systems: exchanging energy (heat and work) and matter with their environment. A boundary allowing matter exchange is called permeable. The ocean would be an example of an open system.


Now in any other person (one with a sense of self-respect and shame) I would expect you to admit your flagrant error of fact and apologize, but since its you Lester, and we know you are incapable of such introspection, I expect you will flee from this fact like a complete coward, and then in a day or so repeat the same lie about the second law of thermodynamics as if this factual correction had never occurred.


Formation of DNA and life is against the laws of nature so they could not have happened naturally. It takes organization overriding the laws of nature to form DNA and life.


Yes, so you keep screaming from the rooftops, before scurrying away like a roack fleeing the light, as soon as anyone asks you for the slightest evidence or justification for that absurd claim.

Seeing as I have just PROVEN that the 'universe is not a closed system' according to the second law of thermodynamics, and seeing as how a snowflake does all the things you just said were impossible (develop information without intelligence, devlop incredibly complex structures from very simple antecedants), it would seem that, one again, you are demonstrated to be flat out wrong.

But, to be fair, you must be getting used to the sting of being proven to be a liar in public by now...




-------
"It is absolutely safe to say that if you meet somebody who claims not to believe in evolution, that person is ignorant, stupid or insane... or wicked, but I'd rather not consider that." (R Dawkins, 1989).

Direct quote from Lester10, in a post referencing Creationism:
"There's absolutely no evidence for it ever having happened. It remains imaginary and philisophical."
 


Posts: 190 | Posted: 03:03 AM on July 30, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Lester
Formation of DNA and life is against the laws of nature so they could not have happened naturally. It takes organization overriding the laws of nature to form DNA and life.
Wisp
Do you think that vain repetition will get you closer to be believed?


Much like buildings building themselves and dinosaurs morphing into hummingbirds, so life putting itself together is against the laws of nature.

You know that instinctively but you'd rather not, so you act dumb.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 05:56 AM on July 30, 2010 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

The more things change, the more they stay the same:
Quote from Apoapsis at 11:04 AM on April 12, 2004 :
YET quote ICR:
The fact is that the various energy sources they cite—solar radiation, lightning, meteorite impacts, radioactivity, volcanoes, and cosmic rays are destructive forces, not constructive. In the absence of both a pre-imposed directing program and complex integrative mechanism (neither of which naturalistic evolution could have), they would never synthesize organisms or increase their complexity; instead they would disintegrate any they encountered!"


However comforting you might find these words, they have only emotional significance, not physical.

Please open any textbook on thermodynamics and try to find a reference to "constructive" vs. "destructive" energy, the distinction exists only in the imagination of creationists.

Amino acids are readily demonstrated to be synthesized from pre-biotic compounds under any of a number of conditions found on a pre-life earth, from the surfaces of interstellar ice grains, to cyanogen-olivine interaction, to the original Miller-Urey lightning experiment.  Subsequent polymerization of amino acids to long chain oligopeptides is also an observed effect of the chemisty of the compounds.  The effect of energy and chemicals forming compounds that is little more mysterious that the formation of nitrate compounds from lightning bolts during the present earth's atmosphere.





-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1348 | Posted: 09:32 AM on July 30, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

However comforting you might find these words, they have only emotional significance, not physical.


The emotional comfort is all yours. Physically, what you have faith in is unreasonable.

Please open any textbook on thermodynamics and try to find a reference to "constructive" vs. "destructive" energy, the distinction exists only in the imagination of creationists.


Energy is energy. The effects are constructive or destructive.

Without a mechanism to utilize the energy, the effect is destructive. Maybe the distinction should start to exist in the minds of evolutionists as well.

Amino acids are readily demonstrated to be synthesized from pre-biotic compounds under any of a number of conditions found on a pre-life earth, from the surfaces of interstellar ice grains, to cyanogen-olivine interaction, to the original Miller-Urey lightning experiment.  


Only by experiments intelligently designed with the correct components and conditions. Even then by-products generally have to be removed lest they cross react with the desired product. Diverse components of living cells frequently require different conditions for their generation and differing cell components can combine rendering them useless for the purpose for which they were 'intelligently' manufactured.

You forget as well that you need information to produce the biomolecules necessary for life from your precursors. Where would you have that come from?
You're still so far from life that you are wandering in the alphabet soup again.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 10:43 AM on July 30, 2010 | IP
Galileo

|     |       Report Post




Member
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 10:43 AM on July 30, 2010 :
Energy is energy. The effects are constructive or destructive.

Without a mechanism to utilize the energy, the effect is destructive. Maybe the distinction should start to exist in the minds of evolutionists as well.


What about gravitational energy? Would you say there is a mechanism to utilise that energy before a star or planet forms?



(Edited by Galileo 7/30/2010 at 4:30 PM).


-------
Hallowed are the Invisible Pink Unicorns
 


Posts: 118 | Posted: 11:15 AM on July 30, 2010 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 10:43 AM on July 30, 2010 :

Only by experiments intelligently designed with the correct components and conditions.


So, you are saying that amino acids are NOT found in meteorites?



-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1348 | Posted: 11:38 AM on July 30, 2010 | IP
Apoapsis

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Quote from Lester10 at 10:43 AM on July 30, 2010 :


Energy is energy. The effects are constructive or destructive.

Without a mechanism to utilize the energy, the effect is destructive.


If a photon is absorbed by a hydrogen atom in interstellar space and the electron is raised to a higher energy state, is that constructive or destructive?



-------
Pogge:” This is the volume of a sphere with a 62 kilometer (about 39 miles) radius, which is considerably smaller than the 2,000 mile radius of the Earth.”
Wikipedia:” For Earth, the mean radius is 6,371.009 km(≈3,958.761 mi; ≈3,440.069 nmi).”
Wisp to Lester (on Pogge): Do you admit he was wrong about the basics?
Lester: No

 


Posts: 1348 | Posted: 6:28 PM on July 30, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Or what if a volcano erupts? That involves a great deal of energy, right?

Constructive or destructive?

Edit: Oh, you listed it as destructive...



You're aware that there are volcanic islands, right? Oh, right... Your god directs them...


(Edited by wisp 7/31/2010 at 12:53 AM).


-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 12:48 AM on July 31, 2010 | IP
wisp

|      |       Report Post




Fanatic
Post Score
Adjustment:
n/a

Rate this post:

The emotional comfort is all yours.
Oh, yeah... Being an ape makes me feel all warm and fuzzy. And furry.

One of these days you cliché responses will make you say "
The love for Jesus is all yours."


-------
Lester
(...) since convergent evolution does NOT lead to homology.
According to people who believe in convergent evolution, it does lead to homologous structures by pure chance mutations in different lines altogether.
porkchop
Would we see a mammal by the water's edge "suddenly" start breathing underwater(w/camera effect of course)?
Contact me at youdebate.1wr@gishpuppy.com
 


Posts: 2551 | Posted: 12:52 AM on July 31, 2010 | IP
Lester10

|     |       Report Post



Fanatic
Post Score
Adjustment:
n/a

Rate this post:

Apoapis
So, you are saying that amino acids are NOT found in meteorites?


I'm saying amino acids are as far from life as alphabet soup is from the Complete Works of Shakespeare. For the organization found in Shakespeare, you need intelligent input. For the organization found in life, you need far more than some amino acids. There is no known natural law that would organize amino acids into life or we would have seen it happening all by itself. You know there's no chance but faith overrides common sense where evolutionists are concerned.


-------
Richard Lewontin: “We take the side of science in spite of the patent absurdity of some of its constructs in spite of the tolerance of the scientific community for unsubstantiated just-so stories, because we have a prior commitment, a commitment to materialism... no matter how counter-intuitive, no matter how mystifying to the uninitiated. Moreover, that materialism is an absolute, for we cannot allow a Divine Foot in the door”
 


Posts: 1308 | Posted: 02:15 AM on July 31, 2010 | IP
    
Multiple pages for this topic [ 1 2 3 4 5 ]

Topic Jump
« Back | Next »
Multiple pages for this topic [ 1 2 3 4 5 ]
Forum moderated by: admin
    

Topic options: Lock topic | Unlock topic | Make Topic Sticky | Remove Sticky | Delete thread | Move thread | Merge thread

 

© YouDebate.com
Powered by: ScareCrow version 2.12
© 2001 Jonathan Bravata. All rights reserved.